LXL04_015139 | RubberDandelionOmics

Gene overview

LXL04_015139

Reference: OH-1004 Chr: Chr03 Coordinates: 64783853-64795777 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3282 bp · LXL04_015139|LXL04_015139|OH1004|cDNA

ATGTTAGGGAAACGCAAGGATTCAGATAGAATTAGCGAACTTCCTCAAGACATAATTGAAAAGATTCTGACTCTGATGCCAATCCGAGATTCATTAAGGACGAGCATATTGTCAAGAAAATGGAGCACTTGGTTGCAGCTTTCGTCTGTTCTATGTGTGATCAGCAGCTCTCCTAATTTGGAGAAGATGAAATTGCAGATGTGTTGGGACCATGATGAATGTCTTGAAGAAACTTTCGAGAAGTCGCATGATCTTCAAGA...

CDS

Download CDS FASTA

3282 bp · LXL04_015139|LXL04_015139|OH1004|CDS

ATGTTAGGGAAACGCAAGGATTCAGATAGAATTAGCGAACTTCCTCAAGACATAATTGAAAAGATTCTGACTCTGATGCCAATCCGAGATTCATTAAGGACGAGCATATTGTCAAGAAAATGGAGCACTTGGTTGCAGCTTTCGTCTGTTCTATGTGTGATCAGCAGCTCTCCTAATTTGGAGAAGATGAAATTGCAGATGTGTTGGGACCATGATGAATGTCTTGAAGAAACTTTCGAGAAGTCGCATGATCTTCAAGA...

Protein

Download Protein FASTA

1093 aa · LXL04_015139|LXL04_015139|OH1004|PROTEIN

MLGKRKDSDRISELPQDIIEKILTLMPIRDSLRTSILSRKWSTWLQLSSVLCVISSSPNLEKMKLQMCWDHDECLEETFEKSHDLQDYMSLKWDHLEEVEITRSPMLKRATIELYESASVKDVSKFGTLAIFTIIFVDFVRILPYMKAQRQTLDRISALPQDTIEKILTLMPIRDALRTSILSRRWRYSWRTIPKLAFDDNEIVESDHNQSVHSDYCEIDNYKFVKAIFHVLLLHRAPILEFSLSSTEKNICSEIDQIIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015139`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015139

Location Chr03:64783853-64795777 (+)

Description Similar to At1g13570: F-box/FBD/LRR-repeat protein At1g13570

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13570`	F-box/FBD/LRR-repeat protein At1g13570.	No verified direct reference in this release
`At5g56370`	FBD-associated F-box protein At5g56370.	No verified direct reference in this release
`At5g56440`	Putative FBD-associated F-box protein At5g56440.	No verified direct reference in this release
`At1g55030`	Putative FBD-associated F-box protein At1g55030.	No verified direct reference in this release
`At4g13965`	Putative F-box/FBD/LRR-repeat protein At4g13965.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015139 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G13570

ath:AT5G56370

ath:AT5G56440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.584

Rank 1 · LXL04_015139 · OH-1004

Nucleus0.501

Rank 2 · LXL04_015139 · OH-1004

Cell membrane0.068

Rank 3 · LXL04_015139 · OH-1004

Endoplasmic reticulum0.050

Rank 4 · LXL04_015139 · OH-1004

Mitochondrion0.035

Rank 5 · LXL04_015139 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box11-45 aa

PF00646.39F-box156-193 aa

PF23622.2LRR_At1g61320_AtMIF1253-346 aa

PF24758.2LRR_At5g56370261-349 aa

PF00646.39F-box722-759 aa

PF24758.2LRR_At5g56370816-922 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015139	`PF00646.39`	F-box	11	45	9.5e-20	70.3
LXL04_015139	`PF00646.39`	F-box	156	193	9.5e-20	70.3
LXL04_015139	`PF23622.2`	LRR_At1g61320_AtMIF1	253	346	1.6e-22	81.2
LXL04_015139	`PF24758.2`	LRR_At5g56370	261	349	6.1e-23	82.4
LXL04_015139	`PF00646.39`	F-box	722	759	9.5e-20	70.3
LXL04_015139	`PF24758.2`	LRR_At5g56370	816	922	6.1e-23	82.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZ70`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At1g13570	31.340%	Swiss-Prot	weak database homology
`Q9FM94`	Arabidopsis thaliana	FBD-associated F-box protein At5g56370	26.667%	Swiss-Prot	weak database homology
`Q9FM87`	Arabidopsis thaliana	Putative FBD-associated F-box protein At5g56440	32.973%	Swiss-Prot	weak database homology
`Q9C7M1`	Arabidopsis thaliana	Putative FBD-associated F-box protein At1g55030	28.571%	Swiss-Prot	weak database homology
`Q3EA38`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At4g13965	28.962%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card