LXL04_013761 | RubberDandelionOmics

Gene overview

LXL04_013761

Reference: OH-1004 Chr: Chr03 Coordinates: 35557737-35559805 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1336 bp · LXL04_013761|LXL04_013761|OH1004|cDNA

ATGGAGCTTGCCCTTCAATCCATATCTCCGGCTCTTCCCAACACTCTGTTCCTCCTCTCTCTCCACCCATCTCCTCTCTCTGCCTTCCCCTACAATCCCCGCCGCCAATTTCAATTCAACGCTCTCTTCTCTTCCGCCGTTGCTTCTCCGTCGAAGCAGTTGCTATGTTCTCACGCTGGAGGCCGGTTCGAACAAGAACAAGTGGaagtagaagaagaagaagaagatgatgaagatgcttACGGAACATCTGCGTTTCT...

CDS

Download CDS FASTA

1251 bp · LXL04_013761|LXL04_013761|OH1004|CDS

ATGGAGCTTGCCCTTCAATCCATATCTCCGGCTCTTCCCAACACTCTGTTCCTCCTCTCTCTCCACCCATCTCCTCTCTCTGCCTTCCCCTACAATCCCCGCCGCCAATTTCAATTCAACGCTCTCTTCTCTTCCGCCGTTGCTTCTCCGTCGAAGCAGTTGCTATGTTCTCACGCTGGAGGCCGGTTCGAACAAGAACAAGTGGAAGTAGAAGAAGAAGAAGAAGATGATGAAGATGCTTACGGAACATCTGCGTTTCT...

Protein

Download Protein FASTA

416 aa · LXL04_013761|LXL04_013761|OH1004|PROTEIN

MELALQSISPALPNTLFLLSLHPSPLSAFPYNPRRQFQFNALFSSAVASPSKQLLCSHAGGRFEQEQVEVEEEEEDDEDAYGTSAFLSLSSKPDRNMAMLDDYEMEELGYLADPNHRSGYVAVVGKPNVGKSTLSNQMIGQKLSIVTDKPQTTRHRILGICSAPEYQMILYDTPGVIEKKMHKLDTMMMKNVRSAAINADCVLVVVDACKTPQNINEVLQEGVGELKENVPVLIVLNKRDLIKPGEMAKKLEWYEKSTDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013761`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013761

Location Chr03:35557737-35559805 (+)

Description Similar to At5g66470: GTPase ERA-like, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66470`	Nuclear genome-encoded probable GTPase involved in ribosome biogenesis in chloroplasts.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0567300`	Nuclear genome-encoded probable GTPase involved in ribosome biogenesis in chloroplasts.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013761 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000028 ribosomal small subunit assembly Biological Process

GO:0006364 rRNA processing Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0019843 rRNA binding Molecular Function

GO:0043024 ribosomal small subunit binding Molecular Function

KEGG gene cross-reference

ath:AT5G66470

dosa:Os05g0567300

gme:Gmet_2315

hmo:HM1_2451

zma:100216562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.817

Rank 1 · LXL04_013761 · OH-1004

Mitochondrion0.170

Rank 2 · LXL04_013761 · OH-1004

Nucleus0.041

Rank 3 · LXL04_013761 · OH-1004

Cytoplasm0.020

Rank 4 · LXL04_013761 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_013761 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926.30MMR_HSR1121-238 aa

PF02421.25FeoB_N121-279 aa

PF00009.34GTP_EFTU121-286 aa

PF03029.24ATP_bind_1165-265 aa

PF03193.23RsgA_GTPase190-283 aa

PF07650.24KH_2321-398 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013761	`PF01926.30`	MMR_HSR1	121	238	1.2e-25	90.6
LXL04_013761	`PF02421.25`	FeoB_N	121	279	4.6e-15	56.2
LXL04_013761	`PF00009.34`	GTP_EFTU	121	286	5.2e-08	33.4
LXL04_013761	`PF03029.24`	ATP_bind_1	165	265	3.1e-06	27.9
LXL04_013761	`PF03193.23`	RsgA_GTPase	190	283	2.3e-10	41.3
LXL04_013761	`PF07650.24`	KH_2	321	398	5.8e-14	52.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZ74`	Arabidopsis thaliana	GTPase ERA-like, chloroplastic	77.212%	Swiss-Prot	strong database homology
`B9FI63`	Oryza sativa subsp. japonica	GTPase ERA-like, chloroplastic	76.048%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card