LXL04_011174 | RubberDandelionOmics

Gene overview

LXL04_011174

Reference: OH-1004 Chr: Chr02 Coordinates: 159353783-159354193 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

411 bp · LXL04_011174|LXL04_011174|OH1004|cDNA

ATGTCCATTTACATTCTATCTTTAGTTAAGCGTTTGATATGGGCTATTGATTTCTTGGTCAACCATGTCTTATTCCACCATCGCATGCTCCACCAGCTGCCGGAAAAGTTTGACTGGATGTCATATGGTGGTGGCGCACTACCAACCGAAGAGGTAGAATGTGCCATTTGTTTGAACAAAGTTGAGGATGATGACGAGATTAGAGAATTAAGATGTGATCATCATTTTCACAAAAACTGCTTGGATATGTGGGTCTCATA...

CDS

Download CDS FASTA

411 bp · LXL04_011174|LXL04_011174|OH1004|CDS

ATGTCCATTTACATTCTATCTTTAGTTAAGCGTTTGATATGGGCTATTGATTTCTTGGTCAACCATGTCTTATTCCACCATCGCATGCTCCACCAGCTGCCGGAAAAGTTTGACTGGATGTCATATGGTGGTGGCGCACTACCAACCGAAGAGGTAGAATGTGCCATTTGTTTGAACAAAGTTGAGGATGATGACGAGATTAGAGAATTAAGATGTGATCATCATTTTCACAAAAACTGCTTGGATATGTGGGTCTCATA...

Protein

Download Protein FASTA

136 aa · LXL04_011174|LXL04_011174|OH1004|PROTEIN

MSIYILSLVKRLIWAIDFLVNHVLFHHRMLHQLPEKFDWMSYGGGALPTEEVECAICLNKVEDDDEIRELRCDHHFHKNCLDMWVSYGHATCPLCRDNLVVPPKINGACEVSSQEVLFFDFCRTSFSDDEGRLWIR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011174`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011174

Location Chr02:159353783-159354193 (+)

Description Similar to XERICO: Probable E3 ubiquitin-protein ligase XERICO

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g63170`	Mediates E2-dependent protein ubiquitination.	No verified direct reference in this release
`At2g04240`	Function on abscisic acid homeostasis at post-translational level, probably through ubiquitin/proteasome-dependent substrate- specific degradation.	Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis.2006 · DOI: 10.1111/j.1365-313x.2006.02782.x Global analysis of della direct targets in early gibberellin signaling in Arabidopsis.2007 · DOI: 10.1105/tpc.107.054999
`At4g40070`	RING-H2 finger protein ATL32.	No verified direct reference in this release
`At3g05200`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At1g72220`	RING-H2 finger protein ATL54.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011174 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009687 abscisic acid metabolic process Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G63170

ath:AT1G72220

ath:AT2G04240

ath:AT3G05200

ath:AT4G40070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.313

Rank 1 · LXL04_011174 · OH-1004

Endoplasmic reticulum0.255

Rank 2 · LXL04_011174 · OH-1004

Nucleus0.246

Rank 3 · LXL04_011174 · OH-1004

Cell membrane0.187

Rank 4 · LXL04_011174 · OH-1004

Golgi apparatus0.172

Rank 5 · LXL04_011174 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_253-96 aa

PF17123.12zf-RING_1153-81 aa

PF00097.32zf-C3HC454-95 aa

PF12678.14zf-rbx154-96 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011174	`PF13639.13`	zf-RING_2	53	96	8.5e-13	49.1
LXL04_011174	`PF17123.12`	zf-RING_11	53	81	2.1e-10	40.8
LXL04_011174	`PF00097.32`	zf-C3HC4	54	95	6.5e-09	36.2
LXL04_011174	`PF12678.14`	zf-rbx1	54	96	1.8e-06	28.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDB8`	Arabidopsis thaliana	E3 ubiquitin-protein ligase At1g63170	56.364%	Swiss-Prot	weak database homology
`Q9SI09`	Arabidopsis thaliana	Probable E3 ubiquitin-protein ligase XERICO	53.846%	Swiss-Prot	weak database homology
`Q8W571`	Arabidopsis thaliana	RING-H2 finger protein ATL32	43.056%	Swiss-Prot	moderate database homology
`Q8RXX9`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL6	56.863%	Swiss-Prot	weak database homology
`Q8LFY8`	Arabidopsis thaliana	RING-H2 finger protein ATL54	41.176%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card