LXL04_005730 | RubberDandelionOmics

Gene overview

LXL04_005730

Reference: OH-1004 Chr: Chr01 Coordinates: 172256710-172257455 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

639 bp · LXL04_005730|LXL04_005730|OH1004|cDNA

ATGGGTGGATTCGACGATCATGGTGGAATAATCGGCGATTGGATGCCTCCAAGCCCTAGCCCACGATCTCTTTTCGCATCCATGTTAGGCGAAGACCCTGGTTCACGATCAGTACCCGATTCTCAAAAACACGACACAGGGTTCACCTTCGATCAACAAATTAGGTTTGAAAACGATGACACGACAAAATCAAGTGAGTTTATCGATCAGAAATCCAGCTCGAGGGCAGGTCTTGTTGAAAGAATGGCGGCAAGAGCGGG...

CDS

Download CDS FASTA

639 bp · LXL04_005730|LXL04_005730|OH1004|CDS

ATGGGTGGATTCGACGATCATGGTGGAATAATCGGCGATTGGATGCCTCCAAGCCCTAGCCCACGATCTCTTTTCGCATCCATGTTAGGCGAAGACCCTGGTTCACGATCAGTACCCGATTCTCAAAAACACGACACAGGGTTCACCTTCGATCAACAAATTAGGTTTGAAAACGATGACACGACAAAATCAAGTGAGTTTATCGATCAGAAATCCAGCTCGAGGGCAGGTCTTGTTGAAAGAATGGCGGCAAGAGCGGG...

Protein

Download Protein FASTA

212 aa · LXL04_005730|LXL04_005730|OH1004|PROTEIN

MGGFDDHGGIIGDWMPPSPSPRSLFASMLGEDPGSRSVPDSQKHDTGFTFDQQIRFENDDTTKSSEFIDQKSSSRAGLVERMAARAGHNAPRLNTEIIKSSDNNSSQNQQTQLPFVSFSPRVSPSSFLESPIFLSNSLVQPSPTTGKFQFGPNGNDNGNGRSSMMFLESSDRIKDNFFQENNNNNNTSFAFKPFPDSASVPRDHVSTIKKPL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005730`
TK1151 ID	TkA01G020450
OH-1004 ID	LXL04_005730
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 87.264 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005730

Location Chr01:172256710-172257455 (+)

Description Similar to WRKY2: Probable WRKY transcription factor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56270`	Transcription factor.	Transcriptional activation of Arabidopsis axis patterning genes WOX8/9 links zygote polarity to embryo development.2011 · DOI: 10.1016/j.devcel.2011.01.009
`At4g26440`	Transcription factor.	No verified direct reference in this release
`At1g55600`	Transcription factor.	MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis.2005 · DOI: 10.1073/pnas.0508418102

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005730 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009409 response to cold Biological Process

GO:0009555 pollen development Biological Process

GO:0009846 pollen germination Biological Process

GO:0009942 longitudinal axis specification Biological Process

GO:0009960 endosperm development Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0030010 establishment of cell polarity Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000987 cis-regulatory region sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G55600

ath:AT4G26440

ath:AT5G56270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.750

Rank 1 · LXL04_005730 · OH-1004

Cytoplasm0.341

Rank 2 · LXL04_005730 · OH-1004

Endoplasmic reticulum0.064

Rank 3 · LXL04_005730 · OH-1004

Cell membrane0.062

Rank 4 · LXL04_005730 · OH-1004

Plastid0.022

Rank 5 · LXL04_005730 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FG77`	Arabidopsis thaliana	Probable WRKY transcription factor 2	40.704%	Swiss-Prot	moderate database homology
`O65590`	Arabidopsis thaliana	Probable WRKY transcription factor 34	30.693%	Swiss-Prot	moderate database homology
`Q9LG05`	Arabidopsis thaliana	Probable WRKY transcription factor 10	32.941%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card