LXL04_004808 | RubberDandelionOmics

Gene overview

LXL04_004808

Reference: OH-1004 Chr: Chr01 Coordinates: 147219521-147227721 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · LXL04_004808|LXL04_004808|OH1004|cDNA

atggtccgggggtgtgacagaatgTGCAAACAGGAATCTAGGCGGATGGCGAGAATTCTAGGGTGTTTGGAAGGCTCCTTCCCCTTCAAGCACCTTGGAGTCCCAGTAGGAGCGAATATGGGACTGAAAAAAAACTGGCAGCCTATTGTAGACAAATTCAAGACTAAGTTATCCTCGTGGAAAGCCAATGCACTCTCATTCGCGGGCAGACTTAGTTTAATAAAATCTGTGATGAGCAACCTTCCAACTTACTTCATGTC...

CDS

Download CDS FASTA

2250 bp · LXL04_004808|LXL04_004808|OH1004|CDS

ATGGTCCGGGGGTGTGACAGAATGTGCAAACAGGAATCTAGGCGGATGGCGAGAATTCTAGGGTGTTTGGAAGGCTCCTTCCCCTTCAAGCACCTTGGAGTCCCAGTAGGAGCGAATATGGGACTGAAAAAAAACTGGCAGCCTATTGTAGACAAATTCAAGACTAAGTTATCCTCGTGGAAAGCCAATGCACTCTCATTCGCGGGCAGACTTAGTTTAATAAAATCTGTGATGAGCAACCTTCCAACTTACTTCATGTC...

Protein

Download Protein FASTA

749 aa · LXL04_004808|LXL04_004808|OH1004|PROTEIN

MVRGCDRMCKQESRRMARILGCLEGSFPFKHLGVPVGANMGLKKNWQPIVDKFKTKLSSWKANALSFAGRLSLIKSVMSNLPTYFMSLFKAPQGIIDTLEKLRRLFLWGDVGGKAKIHWVDWAKIVTDKKDGGLGVGTLKAQNIALLTKWWWRLINDNENSFWKKIIVSIHNLRKKPASYISKKSSTGVWCNIHTAVNYLNDINLDVNKLFRLIPGTSVDILFWKDPWCGESTFQSRFPALYKLDKRKNCSLTDRLSREG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004808`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004808

Location Chr01:147219521-147227721 (+)

Description Similar to HVA22J: HVA22-like protein j

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36020`	HVA22-like protein j.	No verified direct reference in this release
`At5g42560`	HVA22-like protein i.	No verified direct reference in this release
`At1g19950`	HVA22-like protein h.	No verified direct reference in this release
`At1g75700`	Putative HVA22-like protein g.	No verified direct reference in this release
`At1g65750`	Putative ribonuclease H protein At1g65750.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004808 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G19950

ath:AT1G75700

ath:AT2G36020

ath:AT5G42560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.365

Rank 1 · LXL04_004808 · OH-1004

Cytoplasm0.209

Rank 2 · LXL04_004808 · OH-1004

Endoplasmic reticulum0.202

Rank 3 · LXL04_004808 · OH-1004

Nucleus0.133

Rank 4 · LXL04_004808 · OH-1004

Golgi apparatus0.088

Rank 5 · LXL04_004808 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13966.12zf-RVT329-392 aa

PF03134.25TB2_DP1_HVA22532-610 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004808	`PF13966.12`	zf-RVT	329	392	2.6e-16	60.7
LXL04_004808	`PF03134.25`	TB2_DP1_HVA22	532	610	4.1e-24	85.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXE9`	Arabidopsis thaliana	HVA22-like protein j	53.571%	Swiss-Prot	weak database homology
`Q8LE10`	Arabidopsis thaliana	HVA22-like protein i	48.108%	Swiss-Prot	weak database homology
`Q8LEM6`	Arabidopsis thaliana	HVA22-like protein h	51.880%	Swiss-Prot	weak database homology
`Q9LR09`	Arabidopsis thaliana	Putative HVA22-like protein g	51.825%	Swiss-Prot	weak database homology
`P0C2F6`	Arabidopsis thaliana	Putative ribonuclease H protein At1g65750	29.213%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card