LXL04_004575 | RubberDandelionOmics

Gene overview

LXL04_004575

Reference: OH-1004 Chr: Chr01 Coordinates: 140916871-140919628 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

669 bp · LXL04_004575|LXL04_004575|OH1004|cDNA

ATGCAAGCTGCACTTGCAGCTATGGCTGCTCACTCTATCCTCTTCTCTGCTCCCGCCGCCTCTCACTCCCTCCTTTTCCCCATCTCAAACCCTAACACTATCTCCCTTCAATCTTCTTTCCATGGCGTCTCCCTTAAACCCTCCATTGCTCGTCAATCCCTGATACTCTCCGCCACCGCTCCTAAACCCCTCACTGTCGTTGCCGCCGTCAAGAAAGCCGTCGCCGTCCTCAAGGGTACCTCCAGTGTCGAAGGCGTTGT...

CDS

Download CDS FASTA

669 bp · LXL04_004575|LXL04_004575|OH1004|CDS

ATGCAAGCTGCACTTGCAGCTATGGCTGCTCACTCTATCCTCTTCTCTGCTCCCGCCGCCTCTCACTCCCTCCTTTTCCCCATCTCAAACCCTAACACTATCTCCCTTCAATCTTCTTTCCATGGCGTCTCCCTTAAACCCTCCATTGCTCGTCAATCCCTGATACTCTCCGCCACCGCTCCTAAACCCCTCACTGTCGTTGCCGCCGTCAAGAAAGCCGTCGCCGTCCTCAAGGGTACCTCCAGTGTCGAAGGCGTTGT...

Protein

Download Protein FASTA

222 aa · LXL04_004575|LXL04_004575|OH1004|PROTEIN

MQAALAAMAAHSILFSAPAASHSLLFPISNPNTISLQSSFHGVSLKPSIARQSLILSATAPKPLTVVAAVKKAVAVLKGTSSVEGVVTLTQEENGPTTVNVKISGLAPGPHGFHLHEFGDTTNGCISTGPHFNPNGHTHGAPEDEIRHAGDLGNIIANADGVAEATIVDSQIPLTGPNAVVGRAFVVHELADDLGKGGHELSLSTGNAGGRLACGVVGLTPI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004575`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004575

Location Chr01:140916871-140919628 (+)

Description Similar to SODCP: Superoxide dismutase [Cu-Zn], chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28190`	Destroys radicals which are normally produced within the cells and which are toxic to biological systems.	Arabidopsis thaliana ecotype Cvi shows an increased tolerance to photo-oxidative stress and contains a new chloroplastic copper/zinc superoxide dismutase isoenzyme.2001 · DOI: 10.1093/jexbot/52.360.1417 The water-water cycle is essential for chloroplast protection in the absence of stress.2003 · DOI: 10.1074/jbc.m304987200 Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance.2006 · DOI: 10.1105/tpc.106.041673

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004575 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010039 response to iron ion Biological Process

GO:0019430 removal of superoxide radicals Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0035195 miRNA-mediated post-transcriptional gene silencing Biological Process

GO:0046688 response to copper ion Biological Process

GO:0071329 cellular response to sucrose stimulus Biological Process

GO:0071457 cellular response to ozone Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0071484 cellular response to light intensity Biological Process

KEGG gene cross-reference

ath:AT2G28190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.737

Rank 1 · LXL04_004575 · OH-1004

Extracellular0.105

Rank 2 · LXL04_004575 · OH-1004

Cytoplasm0.083

Rank 3 · LXL04_004575 · OH-1004

Mitochondrion0.075

Rank 4 · LXL04_004575 · OH-1004

Lysosome / Vacuole0.044

Rank 5 · LXL04_004575 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00080.26Sod_Cu83-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004575	`PF00080.26`	Sod_Cu	83	217	3.7e-49	167.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O78310`	Arabidopsis thaliana	Superoxide dismutase [Cu-Zn] 2, chloroplastic	74.771%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card