LXL04_004202 | RubberDandelionOmics

Gene overview

LXL04_004202

Reference: OH-1004 Chr: Chr01 Coordinates: 129071293-129073164 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1425 bp · LXL04_004202|LXL04_004202|OH1004|cDNA

ATGAATCTCTCCTCCCCCGTATGGCGTCACCACTCTCCTCCGTCATCGCCGGAAAACTTAATTTTAAATATCAAAGGTCTTAAACTTCCTAGCAACCCGATTAATTCGATTCTTCTTACCAGGAAAAATATTGGATGTTATAATCTTTGGAAATCACGCCCTTCACTCCACTCCAGTTCGATCATTGTAAGTTCTTATGGAGGAGACAGAAAGGCCTATGATGCGACTTCAGACTCTTCTCCGGCGAAGAAACTACGACA...

CDS

Download CDS FASTA

1425 bp · LXL04_004202|LXL04_004202|OH1004|CDS

ATGAATCTCTCCTCCCCCGTATGGCGTCACCACTCTCCTCCGTCATCGCCGGAAAACTTAATTTTAAATATCAAAGGTCTTAAACTTCCTAGCAACCCGATTAATTCGATTCTTCTTACCAGGAAAAATATTGGATGTTATAATCTTTGGAAATCACGCCCTTCACTCCACTCCAGTTCGATCATTGTAAGTTCTTATGGAGGAGACAGAAAGGCCTATGATGCGACTTCAGACTCTTCTCCGGCGAAGAAACTACGACA...

Protein

Download Protein FASTA

474 aa · LXL04_004202|LXL04_004202|OH1004|PROTEIN

MNLSSPVWRHHSPPSSPENLILNIKGLKLPSNPINSILLTRKNIGCYNLWKSRPSLHSSSIIVSSYGGDRKAYDATSDSSPAKKLRQLLDSSGIHQGPACFNALSAKLVERAGFQFCFTTGFGISAARLGLPDTGLISYGEMVEQGQQITESVSIPVIGDGDNGYGNAMNMKRTVKGYIKAGFAGIILEDQVSPKACGHTQGRKVVSREEAVMKIKAAVDARKESGSDIVIVARTDSRQALSLEEALWRSRAFADAGADV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004202`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004202

Location Chr01:129071293-129073164 (+)

Description Similar to Dml: 2,3-dimethylmalate lyase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77060`	Carboxyvinyl-carboxyphosphonate phosphorylmutase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004202 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006107 oxaloacetate metabolic process Biological Process

GO:0017000 antibiotic biosynthetic process Biological Process

GO:0019629 propionate catabolic process, 2-methylcitrate cycle Biological Process

GO:1901848 nicotinate catabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0008807 carboxyvinyl-carboxyphosphonate phosphorylmutase activity Molecular Function

GO:0016740 transferase activity Molecular Function

GO:0016829 lyase activity Molecular Function

GO:0016833 oxo-acid-lyase activity Molecular Function

GO:0030603 oxaloacetase activity Molecular Function

KEGG gene cross-reference

ag:ABC88406

ag:CAA48139

ape:APE_0222.1

ath:AT1G77060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.968

Rank 1 · LXL04_004202 · OH-1004

Mitochondrion0.049

Rank 2 · LXL04_004202 · OH-1004

Cytoplasm0.017

Rank 3 · LXL04_004202 · OH-1004

Nucleus0.016

Rank 4 · LXL04_004202 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_004202 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13714.13PEP_mutase86-332 aa

PF00463.28ICL155-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004202	`PF13714.13`	PEP_mutase	86	332	2.9e-47	162.0
LXL04_004202	`PF00463.28`	ICL	155	241	1.6e-12	47.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49290`	Arabidopsis thaliana	Carboxyvinyl-carboxyphosphonate phosphorylmutase, chloroplastic	40.138%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card