LXL04_001985 | RubberDandelionOmics

Gene overview

LXL04_001985

Reference: OH-1004 Chr: Chr01 Coordinates: 38491704-38494393 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1556 bp · LXL04_001985|LXL04_001985|OH1004|cDNA

TCGTTGTCTCCGCCATGGAAATCGACGGATTTCTCTATGAAACCCTATCCCCTCTAGCAACCAACGTCGCTGTCTCCACCCCCGCATCCACACCGCCGCCGGCTCCCGATCTCCCCAGTGACTCCGAACCGTACCTTGTGCTGCGGAATCATATACCCATTTCTACAAATTCGACGCCCTTGCCGGAAACCTCCGCCCCTGAATTTTTCTCACTCGATGTCGACGCTGATGATTGGAGAACCCCGACGCCGCCGCTCAAA...

CDS

Download CDS FASTA

1542 bp · LXL04_001985|LXL04_001985|OH1004|CDS

ATGGAAATCGACGGATTTCTCTATGAAACCCTATCCCCTCTAGCAACCAACGTCGCTGTCTCCACCCCCGCATCCACACCGCCGCCGGCTCCCGATCTCCCCAGTGACTCCGAACCGTACCTTGTGCTGCGGAATCATATACCCATTTCTACAAATTCGACGCCCTTGCCGGAAACCTCCGCCCCTGAATTTTTCTCACTCGATGTCGACGCTGATGATTGGAGAACCCCGACGCCGCCGCTCAAACGGTCGCGATTGGC...

Protein

Download Protein FASTA

513 aa · LXL04_001985|LXL04_001985|OH1004|PROTEIN

MEIDGFLYETLSPLATNVAVSTPASTPPPAPDLPSDSEPYLVLRNHIPISTNSTPLPETSAPEFFSLDVDADDWRTPTPPLKRSRLAPALPDEEPKRSLEAGWFRANCRFKSPMLQLHKEILDFCDFLSPTPEEAVSRNTAVESVSDVIKYIWPTCKVEVFGSFKTGLFLPSSDVDMVILDSHIRTPQLGLHALSRALSQKGVAKKIQVIAKARVPIIKFVERKSGISFDVSFDMENGPKAAEYIQDAISKWPQLRPLCL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001985`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_001985`
Location	Chr01:38491704-38494393 (+)
Description	Similar to TENT4B: Terminal nucleotidyltransferase 4B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001985` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006302 double-strand break repair Biological Process GO:0006364 rRNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0006401 RNA catabolic process Biological Process GO:0007062 sister chromatid cohesion Biological Process GO:0007076 mitotic chromosome condensation Biological Process GO:0009410 response to xenobiotic stimulus Biological Process GO:0010587 miRNA catabolic process Biological Process GO:0031123 RNA 3'-end processing Biological Process GO:0031124 mRNA 3'-end processing Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0033500 carbohydrate homeostasis Biological Process
KEGG gene cross-reference	dme:Dmel_CG11265 hsa:11044 hsa:64282 mmu:210106 mmu:214627 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.908

Rank 1 · LXL04_001985 · OH-1004

Cytoplasm0.150

Rank 2 · LXL04_001985 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_001985 · OH-1004

Endoplasmic reticulum0.017

Rank 4 · LXL04_001985 · OH-1004

Mitochondrion0.016

Rank 5 · LXL04_001985 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22600.3MTPAP-like_central117-240 aa

PF01909.30NTP_transf_2145-240 aa

PF03828.25PAP_assoc305-363 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001985	`PF22600.3`	MTPAP-like_central	117	240	9.5e-25	88.0
LXL04_001985	`PF01909.30`	NTP_transf_2	145	240	4.6e-07	30.9
LXL04_001985	`PF03828.25`	PAP_assoc	305	363	5.3e-18	65.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card