LXL04_000683 | RubberDandelionOmics

Gene overview

LXL04_000683

Reference: OH-1004 Chr: Chr01 Coordinates: 12581499-12588909 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3429 bp · LXL04_000683|LXL04_000683|OH1004|cDNA

ATGGCTTTCACCCTGTTCATCTTGATCGTACTTCTTAAAGTCTCCTCCGGCGTTTGCAGTCAGAACCTATCCAATTTATTTTCGGCCGTCCTCATTTTTGGGGACTCCACGGCGGATTCAGGGAACAACAACTACATTAATACTCCATTCAAAGCCGACCATCCCCCTTACGGGGAAGATTTTCCGGGAAAAATACCCACCGGCCGGTTCTCAAACGGAAGACTCGTGTCGGACTTTTGGGCGTCTCTGATAGGAATAAA...

CDS

Download CDS FASTA

3429 bp · LXL04_000683|LXL04_000683|OH1004|CDS

ATGGCTTTCACCCTGTTCATCTTGATCGTACTTCTTAAAGTCTCCTCCGGCGTTTGCAGTCAGAACCTATCCAATTTATTTTCGGCCGTCCTCATTTTTGGGGACTCCACGGCGGATTCAGGGAACAACAACTACATTAATACTCCATTCAAAGCCGACCATCCCCCTTACGGGGAAGATTTTCCGGGAAAAATACCCACCGGCCGGTTCTCAAACGGAAGACTCGTGTCGGACTTTTGGGCGTCTCTGATAGGAATAAA...

Protein

Download Protein FASTA

1142 aa · LXL04_000683|LXL04_000683|OH1004|PROTEIN

MAFTLFILIVLLKVSSGVCSQNLSNLFSAVLIFGDSTADSGNNNYINTPFKADHPPYGEDFPGKIPTGRFSNGRLVSDFWASLIGIKQTIPPFLQPNISDFDIRTGVNFASAGSGYDDMTARVSQVIPVTKQLQYFREYLQRLKKVAGVKEAKRIVEGALVSISAGTNDFTISYYDLPSRRQDFSMDDYQDYILKKLQNFVNELYKLGCRTMVVSGLPPMGCLPIQMLSRFSRTCLEDQNTDARVYNQKLTSLLPQIQSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000683`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000683

Location Chr01:12581499-12588909 (-)

Description Similar to At1g58430: GDSL esterase/lipase At1g58430

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g58430`	GDSL esterase/lipase At1g58430.	No verified direct reference in this release
`At2g31540`	GDSL esterase/lipase At2g31540.	No verified direct reference in this release
`At2g24560`	GDSL esterase/lipase At2g24560.	No verified direct reference in this release
`At2g31550`	GDSL esterase/lipase At2g31550.	No verified direct reference in this release
`At2g30220`	GDSL esterase/lipase At2g30220.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000683 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016042 lipid catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016788 hydrolase activity, acting on ester bonds Molecular Function

KEGG gene cross-reference

ath:AT1G58430

ath:AT2G24560

ath:AT2G30220

ath:AT2G31540

ath:AT2G31550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.506

Rank 1 · LXL04_000683 · OH-1004

Nucleus0.324

Rank 2 · LXL04_000683 · OH-1004

Cell membrane0.188

Rank 3 · LXL04_000683 · OH-1004

Endoplasmic reticulum0.074

Rank 4 · LXL04_000683 · OH-1004

Plastid0.066

Rank 5 · LXL04_000683 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00657.29Lipase_GDSL30-300 aa

PF00076.29RRM_1324-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000683	`PF00657.29`	Lipase_GDSL	30	300	1.2e-29	104.6
LXL04_000683	`PF00076.29`	RRM_1	324	374	9.3e-07	29.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C648`	Arabidopsis thaliana	GDSL esterase/lipase At1g58430	54.397%	Swiss-Prot	weak database homology
`Q9SIQ3`	Arabidopsis thaliana	GDSL esterase/lipase At2g31540	54.575%	Swiss-Prot	weak database homology
`Q9SJA9`	Arabidopsis thaliana	GDSL esterase/lipase At2g24560	54.902%	Swiss-Prot	weak database homology
`Q9SIQ2`	Arabidopsis thaliana	GDSL esterase/lipase At2g31550	57.651%	Swiss-Prot	weak database homology
`O22918`	Arabidopsis thaliana	GDSL esterase/lipase At2g30220	53.595%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card