Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1467 bp · LXL04_000549|LXL04_000549|OH1004|cDNA
ATGGCGTTTGATGCTGCCAACAACTCACATTCTTCTCGTTCTCACTTCCAAAAATCAGTTTCTTTACAAGACTGGTGGTTAACTAAACCCCAAACAGATGATGGCAGACCGACAATAGGGGTTTCAGGACTCACTTGCAGTTCTCAACTGAGCCGAGTAGAGCGGTGCTTTTCTTCTGCACCAATCATCAAGGCATACGATTTCTTTGAATTAGAGACTGTTGACGGGATATGTGTCATTCTACAAGGTTATATCAACAA...
1467 bp · LXL04_000549|LXL04_000549|OH1004|CDS
ATGGCGTTTGATGCTGCCAACAACTCACATTCTTCTCGTTCTCACTTCCAAAAATCAGTTTCTTTACAAGACTGGTGGTTAACTAAACCCCAAACAGATGATGGCAGACCGACAATAGGGGTTTCAGGACTCACTTGCAGTTCTCAACTGAGCCGAGTAGAGCGGTGCTTTTCTTCTGCACCAATCATCAAGGCATACGATTTCTTTGAATTAGAGACTGTTGACGGGATATGTGTCATTCTACAAGGTTATATCAACAA...
Protein
Download Protein FASTA488 aa · LXL04_000549|LXL04_000549|OH1004|PROTEIN
MAFDAANNSHSSRSHFQKSVSLQDWWLTKPQTDDGRPTIGVSGLTCSSQLSRVERCFSSAPIIKAYDFFELETVDGICVILQGYINKEKTLENGFSSEVFDHFVIGFPIYWEEYCTSCPKRKSSDECVPRADEDMKDSIEGHEHGNFDDINTTEDCKEIDFSNKASTTPHEECIMKPEDKVLFERPSEIEDERLKNNGLKFSGRRTTRSMTKMPTNKSLSNLNTKNLDESQIDTKDLLRKQNMKASKEKQESDSMSGSKS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_000549 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_000549 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:10117222-10120782 (-) | |||||||||
| Description | Similar to KNL2: Kinetochore-associated protein KNL-2 homolog | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0034080 CENP-A containing chromatin assembly Biological Process GO:0051301 cell division Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0000775 chromosome, centromeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0010369 chromocenter Cellular Component GO:0016604 nuclear body Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G58210 ath:AT5G02520 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF09133.16SANTA20-114 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_000549 | PF09133.16 | SANTA | 20 | 114 | 2.4e-24 | 86.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.