LXL04_000283 | RubberDandelionOmics

Gene overview

LXL04_000283

Reference: OH-1004 Chr: Chr01 Coordinates: 5240504-5247871 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5042 bp · LXL04_000283|LXL04_000283|OH1004|cDNA

GAGCTGCGGGTGGCTCCAACTTCCCTTCCATTTTATCTTCACATCCCTCATTCTCTCCCATTCTCCACACGATCTTCCCCCCcttttctctctctccctctatTGTCACTCTTCATACTTACACCTACATGTTCTTGTTCTTCTAGCGTTTGCGTCTGTTGCTTGCTAGCATGTCTCTTCAGTCTGTAGCTCATGTTAATGGCTACTATTTAAAACCCACATCTGTTTTCGCTTCCAAACGGGACTTTCTGTTTCTCGAT...

CDS

Download CDS FASTA

4893 bp · LXL04_000283|LXL04_000283|OH1004|CDS

TTGCGTCTGTTGCTTGCTAGCATGTCTCTTCAGTCTGTAGCTCATGTTAATGGCTACTATTTAAAACCCACATCTGTTTTCGCTTCCAAACGGGACTTTCTGTTTCTCGATTTTGTAGGTTTGGGCGCTAAACGGACTAATCGGAGATTGCTTGGAGCTGGTGCGAGTGTTCTCAAGAGTGTTGGAGGGTTCCCGAAGAAGAGGAACTGGCCGTCTTCAATCAAATCGGTTCTCGATTTTGATCGCGTTGATCATGTAGA...

Protein

Download Protein FASTA

1630 aa · LXL04_000283|LXL04_000283|OH1004|PROTEIN

MRLLLASMSLQSVAHVNGYYLKPTSVFASKRDFLFLDFVGLGAKRTNRRLLGAGASVLKSVGGFPKKRNWPSSIKSVLDFDRVDHVDADAQQSSDSKRKVANLEDILAQRGSCGVGFIANLDNKGSHQIVEDALTALGCMEHRGGCGADNDSGDGAGLMTSIPWEFFNDWADKQGIAPFDQLHTGVGMVFLPNDESLVEQAKSIIVNIFNQEGLEVLAWRSVPVNAPIVGFYARETMPNIQQVFVRIIKEDDTDDIEREL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000283`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000283

Location Chr01:5240504-5247871 (-)

Description Similar to GLU1: Ferredoxin-dependent glutamate synthase 1, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04140`	Involved in glutamate biosynthesis in leaf.	Arabidopsis gls mutants and distinct Fd-GOGAT genes. Implications for photorespiration and primary nitrogen assimilation.1998 · DOI: 10.1105/tpc.10.5.741
`At2g41220`	May play a role in primary nitrogen assimilation in roots.	Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana--roles of glutamate synthases and carbamoylphosphate synthetase in leaves.2009 · DOI: 10.1111/j.1742-4658.2009.07114.x Arabidopsis gls mutants and distinct Fd-GOGAT genes. Implications for photorespiration and primary nitrogen assimilation.1998 · DOI: 10.1105/tpc.10.5.741

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0658400`	Involved in glutamate biosynthesis in leaf.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000283 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006537 glutamate biosynthetic process Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009853 photorespiration Biological Process

GO:0019676 ammonia assimilation cycle Biological Process

GO:0097054 L-glutamate biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT2G41220

ath:AT5G04140

dosa:Os07g0658400

zma:542710

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.384

Rank 1 · LXL04_000283 · OH-1004

Plastid0.243

Rank 2 · LXL04_000283 · OH-1004

Nucleus0.152

Rank 3 · LXL04_000283 · OH-1004

Mitochondrion0.136

Rank 4 · LXL04_000283 · OH-1004

Peroxisome0.092

Rank 5 · LXL04_000283 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00310.27GATase_2113-535 aa

PF04898.21Glu_syn_central561-854 aa

PF01645.24Glu_synthase914-1297 aa

PF01493.26GXGXG1363-1603 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000283	`PF00310.27`	GATase_2	113	535	2.6e-178	593.8
LXL04_000283	`PF04898.21`	Glu_syn_central	561	854	1.1e-108	363.7
LXL04_000283	`PF01645.24`	Glu_synthase	914	1297	2.2e-156	521.4
LXL04_000283	`PF01493.26`	GXGXG	1363	1603	5e-101	337.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZNZ7`	Arabidopsis thaliana	Ferredoxin-dependent glutamate synthase 1, chloroplastic/mitochondrial	82.154%	Swiss-Prot	strong database homology
`Q9T0P4`	Arabidopsis thaliana	Ferredoxin-dependent glutamate synthase 2, chloroplastic	81.358%	Swiss-Prot	strong database homology
`Q69RJ0`	Oryza sativa subsp. japonica	Ferredoxin-dependent glutamate synthase, chloroplastic	82.236%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card