TkAUNG098840 | RubberDandelionOmics

Gene overview

TkAUNG098840

Reference: TK1151 Chr: ChrUn Coordinates: 27908551-27910604 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · TkAUNG098840|TK1151|cDNA

TGTCCATAGATAAAGCTATCATTAATTACGAACGGAAATTAAACTAACAAAACGTTTTATATAGTGCAGATTTTGGAAATAAATAACTTGTCTTCATTTTCAAATGATAAAAATGGATTGGTTGAAACTTGAGGCGGAGCTTTGACATGCGGGTTGACTGTGTCGATATTATCTAGTCCGCCACTGCTGACCATACCACGTGTCCACTATATTATCCTTTTTCTGAAATTCCTCCCTCCTTCTTCCCACCCCTTTTAAAG...

CDS

Download CDS FASTA

864 bp · TkAUNG098840|TK1151|CDS

ATGCCGTTCTGCGACGTCGGAATTAGCAACAATGGTATCAAGATTTTTTACAGAACCTACGGCGGCGGACCCGTTAAAGTTCTCATGATCATAGGATTGGCTGGGACACACGATTCATGGAAACCACAAATCGAGGGGCTCGTTGGGACGACCCAGGCAAATGATGATAATCGGAGCTCCGAAGACGGTGTGTACAATGGGAATGGTATAGAAATTTGTGCTTTTGATAATCGAGGAATGGGTCGTAGCTCTATACCTAA...

Protein

Download Protein FASTA

288 aa · TkAUNG098840|TK1151|PROTEIN

MPFCDVGISNNGIKIFYRTYGGGPVKVLMIIGLAGTHDSWKPQIEGLVGTTQANDDNRSSEDGVYNGNGIEICAFDNRGMGRSSIPKNKSEYTTKIMASDAISVMNHLGWKKAHVFGHSMGGMIACKLAAVYPDRVVSLALLNVTGGGYQCFPKFDRQSLSIAMRFLRAKTPEQRADVDLDTHYTQEYLEECIGHKTRRQVLYQDYVRGISATGMQSNHGFDGQINACWTHKISKSELEVIRTQGFLISIIHGRSDVIAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG098840`
TK1151 ID	TkAUNG098840
OH-1004 ID	LXL04_011818
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 70.936 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG098840`
Location	ChrUn:27908551-27910604 (+)
Description	Similar to rutD: Putative aminoacrylate hydrolase RutD (Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / NBRC 14845 / NCIMB 13405 / ORS 571)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011818` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006212 uracil catabolic process Biological Process GO:0019740 nitrogen utilization Biological Process GO:0046464 acylglycerol catabolic process Biological Process GO:0016020 membrane Cellular Component GO:0004601 peroxidase activity Molecular Function GO:0016811 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides Molecular Function GO:0047372 monoacylglycerol lipase activity Molecular Function
KEGG gene cross-reference	azc:AZC_2496 mch:Mchl_2054 mdi:METDI2409 mtc:MT0580 mtu:Rv0554 mtv:RVBD_0554 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · TkAUNG098840 · TK1151

Nucleus0.275

Rank 2 · TkAUNG098840 · TK1151

Peroxisome0.200

Rank 3 · TkAUNG098840 · TK1151

Mitochondrion0.105

Rank 4 · TkAUNG098840 · TK1151

Lysosome / Vacuole0.054

Rank 5 · TkAUNG098840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03959FSH125-47 aa

PF00561Abhydrolase_127-286 aa

PF12146Hydrolase_467-185 aa

PF17715DUF556067-114 aa

PF12697Abhydrolase_668-286 aa

PF03096Ndr81-150 aa

PF05990DUF90086-127 aa

PF12695Abhydrolase_5101-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG098840	`PF03959`	FSH1	25	47	0.052	14.0
TkAUNG098840	`PF00561`	Abhydrolase_1	27	286	1.7e-25	90.8
TkAUNG098840	`PF12146`	Hydrolase_4	67	185	6.2e-13	49.3
TkAUNG098840	`PF17715`	DUF5560	67	114	0.18	11.9
TkAUNG098840	`PF12697`	Abhydrolase_6	68	286	4.9e-09	37.8
TkAUNG098840	`PF03096`	Ndr	81	150	2.1e-05	24.1
TkAUNG098840	`PF05990`	DUF900	86	127	0.26	11.4
TkAUNG098840	`PF12695`	Abhydrolase_5	101	132	0.0021	18.6
TkAUNG098840	`PF07819`	PGAP1	109	132	0.014	15.9
TkAUNG098840	`PF00756`	Esterase	113	140	0.0043	17.6
TkAUNG098840	`PF00975`	Thioesterase	114	148	0.0012	19.8
TkAUNG098840	`PF09231`	RDV-p3	174	245	0.43	8.9
TkAUNG098840	`PF07819`	PGAP1	223	260	0.014	15.9
TkAUNG098840	`PF12695`	Abhydrolase_5	247	283	0.0021	18.6
TkAUNG098840	`PF12146`	Hydrolase_4	249	277	6.2e-13	49.3
TkAUNG098840	`PF03959`	FSH1	250	286	0.052	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card