TkAUNG097930 | RubberDandelionOmics

Gene overview

TkAUNG097930

Reference: TK1151 Chr: ChrUn Coordinates: 27669124-27670262 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

982 bp · TkAUNG097930|TK1151|cDNA

TTTCTTTGGTCTAGTTATGCACAAAACAGAGGGCAGCTATCCACAGAGCATGGCAACCACACCCATTCCCATTTCTGCTCCATTTCACAGGCGATTGAAACTACTTTCACCGCCATTGATATTATCCTCAAGGTCAAGGCATCCTCTATTGATCGTGAACTGCAGCATCAGTGAATTCAGTGATACGAAAAGCTCCAAGCTCATCGACCATGGCGGACAACTCATATCAGGTATAGCCGACCAGCAAGTAGATGAATTGT...

CDS

Download CDS FASTA

795 bp · TkAUNG097930|TK1151|CDS

ATGCACAAAACAGAGGGCAGCTATCCACAGAGCATGGCAACCACACCCATTCCCATTTCTGCTCCATTTCACAGGCGATTGAAACTACTTTCACCGCCATTGATATTATCCTCAAGGTCAAGGCATCCTCTATTGATCGTGAACTGCAGCATCAGTGAATTCAGTGATACGAAAAGCTCCAAGCTCATCGACCATGGCGGACAACTCATATCAGGTATAGCCGACCAGCAAGTAGATGAATTGTTCAAAGCCACACAGAG...

Protein

Download Protein FASTA

264 aa · TkAUNG097930|TK1151|PROTEIN

MHKTEGSYPQSMATTPIPISAPFHRRLKLLSPPLILSSRSRHPLLIVNCSISEFSDTKSSKLIDHGGQLISGIADQQVDELFKATQRVELAKKELAEAQKQVIEARKTMQYINPPETRDSKIYKKKEKVESVKAAVISAIVGTIASFPISLTHNVTSTYELIVSTAITISICALYGPTFRYAVRRDLDDSHLKIGTCAAFGIVKGLATLDGRLSLEQDVLNGAVIVSENVLIFVFAAAGLDICYKMGVLSPFPIKQSVSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG097930`
TK1151 ID	TkAUNG097930
OH-1004 ID	LXL04_005725
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	43.600
Protein coverage (%)	TK1151 78.409 / OH-1004 26.006 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG097930`
Location	ChrUn:27669124-27670262 (+)
Description	Similar to YSL3: Metal-nicotianamine transporter YSL3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005725` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0003006 developmental process involved in reproduction Biological Process GO:0006811 monoatomic ion transport Biological Process GO:0006826 iron ion transport Biological Process GO:0009624 response to nematode Biological Process GO:0010039 response to iron ion Biological Process GO:0010043 response to zinc ion Biological Process GO:0048316 seed development Biological Process GO:0005576 extracellular region Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0035673 oligopeptide transmembrane transporter activity Molecular Function
KEGG gene cross-reference	ath:AT4G24120 ath:AT5G24380 ath:AT5G53550 dosa:Os04g0542200 dosa:Os04g0542800 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.982

Rank 1 · TkAUNG097930 · TK1151

Mitochondrion0.021

Rank 2 · TkAUNG097930 · TK1151

Nucleus0.020

Rank 3 · TkAUNG097930 · TK1151

Cytoplasm0.015

Rank 4 · TkAUNG097930 · TK1151

Cell membrane0.013

Rank 5 · TkAUNG097930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19795DUF627948-107 aa

PF21609Toxofilin-like_dom78-126 aa

PF14845Glycohydro_20b295-172 aa

PF14845Glycohydro_20b2189-209 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG097930	`PF19795`	DUF6279	48	107	0.13	12.9
TkAUNG097930	`PF21609`	Toxofilin-like_dom	78	126	0.29	11.9
TkAUNG097930	`PF14845`	Glycohydro_20b2	95	172	0.22	13.0
TkAUNG097930	`PF14845`	Glycohydro_20b2	189	209	0.22	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card