TkAUNG093850 | RubberDandelionOmics

Gene overview

TkAUNG093850

Reference: TK1151 Chr: ChrUn Coordinates: 26557922-26567413 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3733 bp · TkAUNG093850|TK1151|cDNA

CCTCACCTAGTGACCTCTATATAGATAATGATGAGAGATGGAGATGGTTCTAGAAAGAGAAATCCAAAGAGTTTTAGAGCGAGAAAAAGGAGCACGAACAGGGCAGGGAGAAGGGTTCTATCTTTCTTGTCTCTCCAGAATAATCCCTCCGGCGCCGTTTTCTCTCCGGTTGATTCTGCTATTCGGGTCTTGATTCTTTCTCTGTTACCGTTTGTGATTTTCCTCAAAGGATCTATGGCATTCGGAAAACAGATTGATTT...

CDS

Download CDS FASTA

1905 bp · TkAUNG093850|TK1151|CDS

ATGTCACCTAAGTCAGACAGTCCAGTTCAAACTCAAATGGCAGTAGCTCTGTTTAGCAGTCCTTTAGGGAGGGAGTACCATGGAAACAGCAAAATGGAAGGGATGAAGCTTACAGGAAGGAGACGAGTTTTTGTCCAAACAGAATCCGGTTGCGTTTTAGGAATGGAGCTAGATCGATCCGATAACGCCCACACAGTCAAACGAAGGTTACAAATTGCTCTCAGTTTACCAATCGAAGAATCCTCATTGACTTTTGGCGA...

Protein

Download Protein FASTA

634 aa · TkAUNG093850|TK1151|PROTEIN

MSPKSDSPVQTQMAVALFSSPLGREYHGNSKMEGMKLTGRRRVFVQTESGCVLGMELDRSDNAHTVKRRLQIALSLPIEESSLTFGDMVLNNDLSAIRNDSPLLLTRNILHRSSSTPCLSPTGRDHRQKDQSGPVEILGGRSSNFARTKPLVDEVVTAIKSGVDPVPVNGGLGGAYYFKNCRGESVAIVKPTDEEPFAPNNPKGFVGKALGQPGLKRSVRVGETGFREVAAYLLDYDHFANVPPTALVKITHSIFNINDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG093850`
TK1151 ID	TkAUNG093850
OH-1004 ID	LXL04_011141
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.800
Protein coverage (%)	TK1151 98.738 / OH-1004 27.950 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG093850

Location ChrUn:26557922-26567413 (+)

Description Similar to PI4KG7: Phosphatidylinositol 4-kinase gamma 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03890`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3) (By similarity).	Characterization of a new family of protein kinases from Arabidopsis containing phosphoinositide 3/4-kinase and ubiquitin-like domains.2008 · DOI: 10.1042/bj20070959
`At1g13640`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At1g26270`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At2g40850`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At3g56600`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YLX7`	Involved in the import of light-harvesting complex proteins (LHCP) and subsequent routing of these proteins to the chloroplast signal recognition particle (SRP) pathway.	No verified direct reference in this release
`Os07g0520800`	Involved in the import of light-harvesting complex proteins (LHCP) and subsequent routing of these proteins to the chloroplast signal recognition particle (SRP) pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011141 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0046777 protein autophosphorylation Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0004430 1-phosphatidylinositol 4-kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043424 protein histidine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G13640

ath:AT1G26270

ath:AT2G03890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.423

Rank 1 · TkAUNG093850 · TK1151

Cytoplasm0.359

Rank 2 · TkAUNG093850 · TK1151

Cell membrane0.206

Rank 3 · TkAUNG093850 · TK1151

Endoplasmic reticulum0.063

Rank 4 · TkAUNG093850 · TK1151

Plastid0.060

Rank 5 · TkAUNG093850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00454PI3_PI4_kinase173-432 aa

PF03109ABC1313-358 aa

PF08968DUF1885484-559 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG093850	`PF00454`	PI3_PI4_kinase	173	432	2.6e-44	152.7
TkAUNG093850	`PF03109`	ABC1	313	358	0.037	13.9
TkAUNG093850	`PF08968`	DUF1885	484	559	0.034	14.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SI52`	Arabidopsis thaliana	sp\|Q9SI52\|P4KG7_ARATH Phosphatidylinositol 4-kinase gamma 7	63.400%	Swiss-Prot	High
`Q8W4R8`	Arabidopsis thaliana	sp\|Q8W4R8\|P4KG6_ARATH Phosphatidylinositol 4-kinase gamma 6	64.000%	Swiss-Prot	High
`Q9C671`	Arabidopsis thaliana	sp\|Q9C671\|P4KG5_ARATH Phosphatidylinositol 4-kinase gamma 5	61.500%	Swiss-Prot	High
`O22199`	Arabidopsis thaliana	sp\|O22199\|P4KG1_ARATH Phosphatidylinositol 4-kinase gamma 1	41.400%	Swiss-Prot	Medium
`Q0WMZ6`	Arabidopsis thaliana	sp\|Q0WMZ6\|P4KG8_ARATH Phosphatidylinositol 4-kinase gamma 8	51.900%	Swiss-Prot	Medium
`A2YLX7`	Oryza sativa subsp. indica	sp\|A2YLX7\|LTD_ORYSI Protein LHCP TRANSLOCATION DEFECT	61.000%	Swiss-Prot	High
`A3BKF2`	Oryza sativa subsp. japonica	sp\|A3BKF2\|LTD_ORYSJ Protein LHCP TRANSLOCATION DEFECT	61.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card