Gene Card
Gene overview
cDNA / CDS / Protein Sequences
495 bp · TkAUNG093690|TK1151|cDNA
ATGGAGAACTCGTCGGAATCCGGTTGGCAGAGATCCGGCAACTCGCGGGGGTTGAATTCTTCAGGCGTTTCGAACAGAATTCCTAGAATAACCCCTACAGGAGCGTTCAGATTCTCAGGCGACACAGATCATGATTCCGTTGAAGCGAAGGACGTGAGCTTACGTCAGTGGTTAGACAACAAAGAACGCGTCGTCGATGCTCTCGAATGCTTACTTATATTTATGCAGATCGTTGAAATCGTGAACCTGGCACATTCCCA...
495 bp · TkAUNG093690|TK1151|CDS
ATGGAGAACTCGTCGGAATCCGGTTGGCAGAGATCCGGCAACTCGCGGGGGTTGAATTCTTCAGGCGTTTCGAACAGAATTCCTAGAATAACCCCTACAGGAGCGTTCAGATTCTCAGGCGACACAGATCATGATTCCGTTGAAGCGAAGGACGTGAGCTTACGTCAGTGGTTAGACAACAAAGAACGCGTCGTCGATGCTCTCGAATGCTTACTTATATTTATGCAGATCGTTGAAATCGTGAACCTGGCACATTCCCA...
Protein
Download Protein FASTA164 aa · TkAUNG093690|TK1151|PROTEIN
MENSSESGWQRSGNSRGLNSSGVSNRIPRITPTGAFRFSGDTDHDSVEAKDVSLRQWLDNKERVVDALECLLIFMQIVEIVNLAHSQGFVVHNVRPSCFVMSSFNRVSFIESVSCSDSGSDSCDDVSNNNNQTADFMGLCSSSGPDRVNQNQTQTQTQTADLIA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG093690 |
|---|---|
| TK1151 ID | TkAUNG093690 |
| OH-1004 ID | LXL04_037649 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 75.500 |
| Protein coverage (%) | TK1151 91.463 / OH-1004 22.967Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG093690 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:26513902-26514519 (+) | |||||||||
| Description | Similar to SPA3: Protein SPA1-RELATED 3 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006281 DNA repair Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0009637 response to blue light Biological Process GO:0009640 photomorphogenesis Biological Process GO:0009641 shade avoidance Biological Process GO:0009647 skotomorphogenesis Biological Process GO:0009649 entrainment of circadian clock Biological Process GO:0009658 chloroplast organization Biological Process GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process GO:0010017 red or far-red light signaling pathway Biological Process GO:0010100 negative regulation of photomorphogenesis Biological Process GO:0010114 response to red light Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G53090 ath:AT2G32950 ath:AT2G46340 ath:AT3G15354 ath:AT4G11110 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.