TkAUNG089310 | RubberDandelionOmics

Gene overview

TkAUNG089310

Reference: TK1151 Chr: ChrUn Coordinates: 25347217-25350566 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2677 bp · TkAUNG089310|TK1151|cDNA

CTCCTCTCATCCTCTGTTACGATTTTTGAAATTGATTTGTAAATTATGATTTTGAAGAATCATTGACTCAGAATCTAGAAGGTTATAGAAGTTAAACGAGAAGCAACAGTAAAAGCATGGCTTTTGTGCAACAGTAAAAGCATGGCTTTTGTACAAATAAGGCCACACAGAGTCGCAAACTTGTCACTCGTCTCTTCGACTTCAATCTTCTCAATCAAGTCCTGCGACTTATCTTTCCTTGCAGATATGAGTTGCAGTTT...

CDS

Download CDS FASTA

1416 bp · TkAUNG089310|TK1151|CDS

ATGGCTTTTGTACAAATAAGGCCACACAGAGTCGCAAACTTGTCACTCGTCTCTTCGACTTCAATCTTCTCAATCAAGTCCTGCGACTTATCTTTCCTTGCAGATATGAGTTGCAGTTTGGTTTCTCCGGAGTTGGGAACTAGTTTCCTTTCATGTGGACAAAGAATTATTCCTCCCAACTTGGGAATTTTCAGATACGACCCAAATCCACCACAGACCCTCCTCAAATTCCCTTCTTCTTCTTCTTCTTCTTCTTCTTC...

Protein

Download Protein FASTA

471 aa · TkAUNG089310|TK1151|PROTEIN

MAFVQIRPHRVANLSLVSSTSIFSIKSCDLSFLADMSCSLVSPELGTSFLSCGQRIIPPNLGIFRYDPNPPQTLLKFPSSSSSSSSSSSSSSSKHSLAIRCNNKNANPQNVDLPRHYSKKEKKPFPVPILELRRAARERMKTRKHQPQRSGGPPPPKNGLLVQSMIPLAYSVLNARTSLINNLKKLLKVIPVKACKYCNEIHVGPVGHPFRSCQGQNSSARKGKHEWVDAVVEDIIVQIESYHLEDRLGKRIPHEDRFSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG089310`
TK1151 ID	TkAUNG089310
OH-1004 ID	LXL04_035051
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.100
Protein coverage (%)	TK1151 92.569 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG089310

Location ChrUn:25347217-25350566 (+)

Description Similar to APO2: APO protein 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57930`	May be involved in the stable assembly of several 4Fe-4S cluster-containing complexes of chloroplasts.	No verified direct reference in this release
`At1g64810`	Involved in the stable assembly of several 4Fe-4S cluster- containing complexes of chloroplasts.	ACCUMULATION OF PHOTOSYSTEM ONE1, a member of a novel gene family, is required for accumulation of [4Fe-4S] cluster-containing chloroplast complexes and antenna proteins.2004 · DOI: 10.1105/tpc.104.024935
`At5g61930`	May be involved in the stable assembly of several 4Fe-4S cluster-containing complexes of mitochondria.	No verified direct reference in this release
`At3g21740`	May be involved in the stable assembly of several 4Fe-4S cluster-containing complexes of mitochondria.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035051 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0009615 response to virus Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0015979 photosynthesis Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G64810

ath:AT3G21740

ath:AT5G57930

ath:AT5G61930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.892

Rank 1 · TkAUNG089310 · TK1151

Nucleus0.075

Rank 2 · TkAUNG089310 · TK1151

Mitochondrion0.071

Rank 3 · TkAUNG089310 · TK1151

Cytoplasm0.044

Rank 4 · TkAUNG089310 · TK1151

Cell membrane0.028

Rank 5 · TkAUNG089310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27961CSNKA2IP68-102 aa

PF10500SR-2579-147 aa

PF15761IMUP79-123 aa

PF25329C2_GDE180-125 aa

PF05634APO_RNA-bind102-299 aa

PF30079Merozoite_surf_9_helical178-200 aa

PF23475zf-Tbcl_FmdE192-217 aa

PF05634APO_RNA-bind337-448 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG089310	`PF27961`	CSNKA2IP	68	102	0.11	12.7
TkAUNG089310	`PF10500`	SR-25	79	147	0.017	15.5
TkAUNG089310	`PF15761`	IMUP	79	123	0.5	11.9
TkAUNG089310	`PF25329`	C2_GDE1	80	125	0.08	14.0
TkAUNG089310	`PF05634`	APO_RNA-bind	102	299	7.4e-116	385.3
TkAUNG089310	`PF30079`	Merozoite_surf_9_helical	178	200	0.013	15.8
TkAUNG089310	`PF23475`	zf-Tbcl_FmdE	192	217	6.9	6.9
TkAUNG089310	`PF05634`	APO_RNA-bind	337	448	7.4e-116	385.3
TkAUNG089310	`PF23475`	zf-Tbcl_FmdE	357	370	6.9	6.9
TkAUNG089310	`PF30079`	Merozoite_surf_9_helical	363	370	0.013	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4A5`	Arabidopsis thaliana	sp\|Q8W4A5\|APO2_ARATH APO protein 2, chloroplastic	67.600%	Swiss-Prot	High
`Q9XIR4`	Arabidopsis thaliana	sp\|Q9XIR4\|APO1_ARATH APO protein 1, chloroplastic	44.600%	Swiss-Prot	Medium
`Q9FH50`	Arabidopsis thaliana	sp\|Q9FH50\|APO3_ARATH APO protein 3, mitochondrial	43.100%	Swiss-Prot	Medium
`Q9LSZ0`	Arabidopsis thaliana	sp\|Q9LSZ0\|APO4_ARATH APO protein 4, mitochondrial	36.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card