Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3803 bp · TkAUNG088590|TK1151|cDNA
CAAAGCTCGATGGAGCAGTTTTTATGTAGAACCATTTACAGAGGCAAGAAATCAAACCATCCTCGAAGACGGGCGGTTCCCAACAAATGATTTTCTCTAAGCTCCTCAAATCCAAAAGATTCTCTACTTCTCGATCATCTTCTTCCTCTCGTCGCAACCACCAAAAATTTGTGTCACTCGCTACCTTCTTGAAATGTAGTTTCAATTTATCTCTCAAACATTACAACAACTTTCTTCTTCAACTCTTCAGAACCAAAAAA...
2757 bp · TkAUNG088590|TK1151|CDS
ATGATTTTCTCTAAGCTCCTCAAATCCAAAAGATTCTCTACTTCTCGATCATCTTCTTCCTCTCGTCGCAACCACCAAAAATTTGTGTCACTCGCTACCTTCTTGAAATGTAGTTTCAATTTATCTCTCAAACATTACAACAACTTTCTTCTTCAACTCTTCAGAACCAAAAAATTTCGATTCATCACACACTTCATATCTCAACTAAACTCCAACCATATCGAAGGAGATCATATCACAAAATCAATCTTCACAAGGGC...
Protein
Download Protein FASTA918 aa · TkAUNG088590|TK1151|PROTEIN
MIFSKLLKSKRFSTSRSSSSSRRNHQKFVSLATFLKCSFNLSLKHYNNFLLQLFRTKKFRFITHFISQLNSNHIEGDHITKSIFTRALLKQHNYEKAVEFINTQIRKTPTILQNQILDSLAQGFCLNQKDPERGFSVLRDYLKIDGILPSSFTFCALINSFSRQGKMNRAIEVLEVMTDEKFKYPFDNFVVSAVISGFINAGNPELAVGFYQNAAKSTALQMNIVTYTCLLSAYCRLKNFKEVSELLNSIKKDGLSVDVV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG088590 |
|---|---|
| TK1151 ID | TkAUNG088590 |
| OH-1004 ID | LXL04_028433 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 97.900 |
| Protein coverage (%) | TK1151 91.939 / OH-1004 79.849Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG088590 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:25133922-25140041 (-) | |||||||||
| Description | Similar to At5g57250: Pentatricopeptide repeat-containing protein At5g57250, mitochondrial | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000963 mitochondrial RNA processing Biological Process GO:0006412 translation Biological Process GO:0008380 RNA splicing Biological Process GO:0032544 plastid translation Biological Process GO:0043489 RNA stabilization Biological Process GO:0005739 mitochondrion Cellular Component GO:0009507 chloroplast Cellular Component GO:0003729 mRNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G19290 ath:AT4G31850 ath:AT5G57250 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF29838E02H4_M12-33 aaPF29070MSC6_N30-208 aaPF13812PPR_341-74 aaPF13041PPR_246-89 aaPF23276TPR_2466-99 aaPF01535PPR86-101 aaPF13428TPR_1486-109 aaPF14559TPR_1986-109 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG088590 | PF29838 | E02H4_M | 12 | 33 | 0.082 | 13.2 |
| TkAUNG088590 | PF29070 | MSC6_N | 30 | 208 | 1.4e-28 | 100.9 |
| TkAUNG088590 | PF13812 | PPR_3 | 41 | 74 | 4.6e-56 | 187.5 |
| TkAUNG088590 | PF13041 | PPR_2 | 46 | 89 | 2e-119 | 390.3 |
| TkAUNG088590 | PF23276 | TPR_24 | 66 | 99 | 2.9e-42 | 144.4 |
| TkAUNG088590 | PF01535 | PPR | 86 | 101 | 2.1e-101 | 326.1 |
| TkAUNG088590 | PF13428 | TPR_14 | 86 | 109 | 3.5e-05 | 24.8 |
| TkAUNG088590 | PF14559 | TPR_19 | 86 | 109 | 0.013 | 16.6 |
| TkAUNG088590 | PF25068 | ARM_TT21_4th | 86 | 108 | 0.035 | 15.1 |
| TkAUNG088590 | PF13041 | PPR_2 | 87 | 102 | 2e-119 | 390.3 |
| TkAUNG088590 | PF07719 | TPR_2 | 87 | 101 | 0.013 | 16.3 |
| TkAUNG088590 | PF00515 | TPR_1 | 87 | 100 | 0.016 | 15.7 |
| TkAUNG088590 | PF13414 | TPR_11 | 87 | 99 | 0.83 | 10.1 |
| TkAUNG088590 | PF14689 | SPOB_a | 88 | 107 | 0.011 | 16.0 |
| TkAUNG088590 | PF31234 | TPR_Psidin_N | 89 | 121 | 0.00018 | 21.8 |
| TkAUNG088590 | PF12921 | ATP13 | 103 | 139 | 1.1e-09 | 38.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q9LVD3 | Arabidopsis thaliana | sp|Q9LVD3|PP434_ARATH Pentatricopeptide repeat-containing protein At5g57250, mitochondrial | 48.000% | Swiss-Prot | Medium |
Q9ZVX5 | Arabidopsis thaliana | sp|Q9ZVX5|PP156_ARATH Pentatricopeptide repeat-containing protein At2g16880 | 37.800% | Swiss-Prot | Low |