TkAUNG084540 | RubberDandelionOmics

Gene overview

TkAUNG084540

Reference: TK1151 Chr: ChrUn Coordinates: 24044804-24051454 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2496 bp · TkAUNG084540|TK1151|cDNA

TTGATTTCCAAGACATTCTTCAAAAGATTTGCACTTGATAATATTTGTATAATCGCTTTTGGGTATGATGATGGCTTCAAGTTTGATTTCCCGATCCTTCCACTTCGTTTCTCAAAATTATGACACTCCTTCTTGCCCTTCAGTTCAATTGATAGCTCTTCTTAAGTTTTCCTGCCATGAATAACAATCCACAGTTTAAACAAAGCCTTCCCCATTTCATTTCGTCAACCTTTATTACTTTAGTGTATATTAATGTTGCT...

CDS

Download CDS FASTA

3669 bp · TkAUNG084540|TK1151|CDS

ATGCCCAGTAGTTGCAGCATTCGAGCTCTCTGGATACTCAACAATCAAGATACCGTCGTCTTCTCCCGGAGGTTTTCGGTGGTTGAGAGACGTTGGAGTGTTGCTTGCAAGAAAGCAAATGAGAGGTCCGAAGATACTCAAGATGCAAATCTGTTGTCATCGTATCTCCCCACAGATTCTGAGTTAGCTGATGCGTTTGCAGACCGAAAAAAGAGGGAAGGATCTGTTCGTGGGTACGGAATACGGGTCAAACAGTCAAT...

Protein

Download Protein FASTA

1222 aa · TkAUNG084540|TK1151|PROTEIN

MPSSCSIRALWILNNQDTVVFSRRFSVVERRWSVACKKANERSEDTQDANLLSSYLPTDSELADAFADRKKREGSVRGYGIRVKQSIEGSDSWVDDPIMRHIISLHLKKEEDEKTHTFWPLILHTKGQYYILVLPLVEPHHLKSYKTLSTRSDCGNGVAVDENGNLSSLLLQLPSITGYGKFLEAFMVAHVLGDIITSDFQEPEVVVNAGPSVGGLLDSLTGSIGISARPKPVAAPVATSTNSTTASGGSDSPKIGPKNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG084540`
TK1151 ID	TkAUNG084540
OH-1004 ID	LXL04_005573
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	71.000
Protein coverage (%)	TK1151 46.154 / OH-1004 20.556 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG084540

Location ChrUn:24044804-24051454 (+)

Description Similar to RPPL1: Putative disease resistance RPP13-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20790`	AP-5 complex subunit mu.	No verified direct reference in this release
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release
`At3g14460`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005573 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0004016 adenylate cyclase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14460

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.299

Rank 1 · TkAUNG084540 · TK1151

Cytoplasm0.257

Rank 2 · TkAUNG084540 · TK1151

Endoplasmic reticulum0.189

Rank 3 · TkAUNG084540 · TK1151

Nucleus0.173

Rank 4 · TkAUNG084540 · TK1151

Golgi apparatus0.140

Rank 5 · TkAUNG084540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06739SBBP153-166 aa

PF00928Adap_comp_sub315-611 aa

PF06739SBBP603-623 aa

PF18052Rx_N646-729 aa

PF03980Nnf1712-779 aa

PF29780CfpA_N717-782 aa

PF00931NB-ARC817-983 aa

PF23559WHD_DRP1043-1110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG084540	`PF06739`	SBBP	153	166	0.26	12.0
TkAUNG084540	`PF00928`	Adap_comp_sub	315	611	2.1e-22	80.5
TkAUNG084540	`PF06739`	SBBP	603	623	0.26	12.0
TkAUNG084540	`PF18052`	Rx_N	646	729	4.5e-21	75.5
TkAUNG084540	`PF03980`	Nnf1	712	779	0.014	16.4
TkAUNG084540	`PF29780`	CfpA_N	717	782	0.16	13.3
TkAUNG084540	`PF00931`	NB-ARC	817	983	5.1e-32	111.5
TkAUNG084540	`PF23559`	WHD_DRP	1043	1110	3.2e-20	72.7
TkAUNG084540	`PF18052`	Rx_N	1104	1138	4.5e-21	75.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W0Z6`	Arabidopsis thaliana	sp\|Q8W0Z6\|AP5M_ARATH AP-5 complex subunit mu	61.900%	Swiss-Prot	High
`Q9LRR4`	Arabidopsis thaliana	sp\|Q9LRR4\|R13L1_ARATH Putative disease resistance RPP13-like protein 1	35.200%	Swiss-Prot	Low
`Q9LRR5`	Arabidopsis thaliana	sp\|Q9LRR5\|DRL21_ARATH Putative disease resistance protein At3g14460	31.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card