TkAUNG078640 | RubberDandelionOmics

Gene overview

TkAUNG078640

Reference: TK1151 Chr: ChrUn Coordinates: 22487065-22489306 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2216 bp · TkAUNG078640|TK1151|cDNA

AAAAAACATGAAAAAACAACTTGACTTCTGATGAAATATACCTAAATTTTATACAATGAAATATGGAGCCATCGTCGCTTTTATTAATTCAATATGAATTTCGTTATTACATATCAAACAAGTTGACTCAGAAGTCAAAATAGGGAAACGAAAATGATATGAACATAACACTCAGCGGCATATGCAGAGAGCAATTTCATCGATTAGCTGATCAATTTTCATCAAATTCATTTCTTTTCGAATGTCACGAAGAAACATAA...

CDS

Download CDS FASTA

1839 bp · TkAUNG078640|TK1151|CDS

ATGTCACGAAGAAACATAAATCTCGTTTCTCAAATCCGTCGTCGTCATATCTTCTCCTACGCTTCAAGATTCCATTATCATCATAAGCTCTCGCCAATTGTAAGTTCATCACTACCTCTGTCTCATAGCTATTTCAGTGCTCCCATCCCGAATTCGTCGAACAAATTGTTTAAAGTTAGTGTCTTTCCACTTCCGAATTCCTTTCCACAAACGAGTAAGGGCAATTTGACATGGATTCACTATTATAGTGAAGGCGGTAA...

Protein

Download Protein FASTA

612 aa · TkAUNG078640|TK1151|PROTEIN

MSRRNINLVSQIRRRHIFSYASRFHYHHKLSPIVSSSLPLSHSYFSAPIPNSSNKLFKVSVFPLPNSFPQTSKGNLTWIHYYSEGGNDAFDRTHGGQISTLSNDGELYEKEGDSGSDAIALDKKPNPCVPISINGQNLYNIIIDCKLNNPQNSNMEKSLDEIGAQLTTPLVMEVLGSLRYQETLAFRFFTWAGNQENYTHEPQAYNEMIDILSNTKYKAKQYRIVCDLLDYMKRNNKTRVPIESLLKILKQYADKHLAHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG078640`
TK1151 ID	TkAUNG078640
OH-1004 ID	LXL04_005553
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG078640

Location ChrUn:22487065-22489306 (-)

Description Similar to At1g73400: Pentatricopeptide repeat-containing protein At1g73400, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g73400`	Pentatricopeptide repeat-containing protein At1g73400, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005553 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G73400

ath:AT1G77360

ath:AT3G62470

ath:AT3G62540

ath:AT5G14820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.665

Rank 1 · TkAUNG078640 · TK1151

Plastid0.197

Rank 2 · TkAUNG078640 · TK1151

Nucleus0.088

Rank 3 · TkAUNG078640 · TK1151

Cytoplasm0.031

Rank 4 · TkAUNG078640 · TK1151

Cell membrane0.011

Rank 5 · TkAUNG078640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06239ECSIT_N55-70 aa

PF13041PPR_2139-149 aa

PF12854PPR_1139-145 aa

PF31094DUF8807156-221 aa

PF17177PPR_long197-299 aa

PF24760TPR_IF140_C197-290 aa

PF06239ECSIT_N203-221 aa

PF13041PPR_2204-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG078640	`PF06239`	ECSIT_N	55	70	0.11	12.5
TkAUNG078640	`PF13041`	PPR_2	139	149	6e-63	209.5
TkAUNG078640	`PF12854`	PPR_1	139	145	2.1e-48	162.4
TkAUNG078640	`PF31094`	DUF8807	156	221	0.051	14.3
TkAUNG078640	`PF17177`	PPR_long	197	299	1.1e-16	61.6
TkAUNG078640	`PF24760`	TPR_IF140_C	197	290	0.39	11.8
TkAUNG078640	`PF06239`	ECSIT_N	203	221	0.11	12.5
TkAUNG078640	`PF13041`	PPR_2	204	236	6e-63	209.5
TkAUNG078640	`PF01535`	PPR	218	236	4.9e-40	133.7
TkAUNG078640	`PF13812`	PPR_3	218	235	6.3e-28	97.4
TkAUNG078640	`PF29070`	MSC6_N	231	405	1e-12	48.6
TkAUNG078640	`PF23276`	TPR_24	234	301	9.4e-19	68.4
TkAUNG078640	`PF24760`	TPR_IF140_C	265	303	0.39	11.8
TkAUNG078640	`PF13812`	PPR_3	267	289	6.3e-28	97.4
TkAUNG078640	`PF06239`	ECSIT_N	267	294	0.11	12.5
TkAUNG078640	`PF12854`	PPR_1	274	301	2.1e-48	162.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX35`	Arabidopsis thaliana	sp\|Q9FX35\|PP117_ARATH Pentatricopeptide repeat-containing protein At1g73400, mitochondrial	66.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card