TkAUNG077510 | RubberDandelionOmics

Gene overview

TkAUNG077510

Reference: TK1151 Chr: ChrUn Coordinates: 22232308-22233337 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

702 bp · TkAUNG077510|TK1151|cDNA

ATGACTACTACTACCGCCGTATACGGTGGTGGTTCTAACCACCAAGAAACATTTCCATCTTCTTTTACCAATTTCAACTCTGCTCTCACCGCCGGACTCTTGAATCCGATGTCGCCTCCCCCACCCACCTCCGATAAAACCCGATCCAGCCCTACCCTTTTCGAGATGATGGCAAACGAACCTGATTGTAAGATCCCCAATAACTCAAACGGCAATGCTTCACTTTCATACCCAACCCCTAAAAAACCCAACAATCATGT...

CDS

Download CDS FASTA

702 bp · TkAUNG077510|TK1151|CDS

ATGACTACTACTACCGCCGTATACGGTGGTGGTTCTAACCACCAAGAAACATTTCCATCTTCTTTTACCAATTTCAACTCTGCTCTCACCGCCGGACTCTTGAATCCGATGTCGCCTCCCCCACCCACCTCCGATAAAACCCGATCCAGCCCTACCCTTTTCGAGATGATGGCAAACGAACCTGATTGTAAGATCCCCAATAACTCAAACGGCAATGCTTCACTTTCATACCCAACCCCTAAAAAACCCAACAATCATGT...

Protein

Download Protein FASTA

233 aa · TkAUNG077510|TK1151|PROTEIN

MTTTTAVYGGGSNHQETFPSSFTNFNSALTAGLLNPMSPPPPTSDKTRSSPTLFEMMANEPDCKIPNNSNGNASLSYPTPKKPNNHVIPPPPIIIDKQALLQQRLLDLLSIRSPGSQYNDPNSSDVKLTLTSKDGLSVSMNAHRQILVGHSRFFASKISDYRWKGGQQGQQPYIIEISDCDDVEVYIESIRLMYCKDLRRKLMREDVPRVLGILKLSAAIGFDAGVFNLVWSI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG077510`
TK1151 ID	TkAUNG077510
OH-1004 ID	LXL04_005544
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.400
Protein coverage (%)	TK1151 97.854 / OH-1004 35.404 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG077510

Location ChrUn:22232308-22233337 (-)

Description Similar to At1g63850: BTB/POZ domain-containing protein At1g63850

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g63850`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g60050`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g50780`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005544 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G63850

ath:AT2G13690

ath:AT3G05675

ath:AT3G50780

ath:AT5G60050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.746

Rank 1 · TkAUNG077510 · TK1151

Cytoplasm0.289

Rank 2 · TkAUNG077510 · TK1151

Cell membrane0.056

Rank 3 · TkAUNG077510 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkAUNG077510 · TK1151

Lysosome / Vacuole0.021

Rank 5 · TkAUNG077510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651BTB124-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG077510	`PF00651`	BTB	124	210	0.029	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAJ9`	Arabidopsis thaliana	sp\|Q9CAJ9\|Y1385_ARATH BTB/POZ domain-containing protein At1g63850	61.200%	Swiss-Prot	High
`Q9LVG9`	Arabidopsis thaliana	sp\|Q9LVG9\|Y5600_ARATH BTB/POZ domain-containing protein At5g60050	48.100%	Swiss-Prot	Low
`Q9SVM0`	Arabidopsis thaliana	sp\|Q9SVM0\|Y3078_ARATH BTB/POZ domain-containing protein At3g50780	38.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card