TkAUNG073270 | RubberDandelionOmics

Gene overview

TkAUNG073270

Reference: TK1151 Chr: ChrUn Coordinates: 21147403-21148863 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1461 bp · TkAUNG073270|TK1151|cDNA

ATGTTATCCACTTGCTCAAGAAACGTATACGAAATGGTCACTGATTTCGATTGGTACGTGTCACTTCTTGGAGAAATGGCAAGAATCCCACATTGCCAAAATGGAGAAGAAATAGAATACCAGTTAATAGACATTGGCATGAGGGTCAAAGATGTCAGACCAGAGCTTGTTCGTATTGGACGCGATCTATTAATAGATCCCGCTTTACTTGGTAACCCTTCCATTCATACAATATTATCAGCTGCTTCTTGGGTGTCAGG...

CDS

Download CDS FASTA

1461 bp · TkAUNG073270|TK1151|CDS

ATGTTATCCACTTGCTCAAGAAACGTATACGAAATGGTCACTGATTTCGATTGGTACGTGTCACTTCTTGGAGAAATGGCAAGAATCCCACATTGCCAAAATGGAGAAGAAATAGAATACCAGTTAATAGACATTGGCATGAGGGTCAAAGATGTCAGACCAGAGCTTGTTCGTATTGGACGCGATCTATTAATAGATCCCGCTTTACTTGGTAACCCTTCCATTCATACAATATTATCAGCTGCTTCTTGGGTGTCAGG...

Protein

Download Protein FASTA

486 aa · TkAUNG073270|TK1151|PROTEIN

MLSTCSRNVYEMVTDFDWYVSLLGEMARIPHCQNGEEIEYQLIDIGMRVKDVRPELVRIGRDLLIDPALLGNPSIHTILSAASWVSGEYIRFSKNPFEIMEALLQPRTNLLSPSIKAIYIHSTYKVLSFCLHSFLFPHTSTISVSNLVDEHEPGFTYSESEGDTNADLATTSKNTITRESIINLLALVLSSLTPLAETHDVEIQERVRNVLGLARLAQEEISSCDTLQKESIFAVKHSVIIRLINDALSEDLGPVSLSAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG073270`
TK1151 ID	TkAUNG073270
OH-1004 ID	LXL04_020198
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 54.484 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG073270

Location ChrUn:21147403-21148863 (-)

Description Similar to DELTA-ADR: AP-3 complex subunit delta

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48760`	Part of the AP-3 complex, an adaptor-related complex which seems to be clathrin-associated.	The AP-3 adaptor complex is required for vacuolar function in Arabidopsis.2011 · DOI: 10.1038/cr.2011.99

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020198 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006623 protein targeting to vacuole Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0006903 vesicle targeting Biological Process

GO:0007032 endosome organization Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0019882 antigen processing and presentation Biological Process

GO:0032438 melanosome organization Biological Process

GO:0035646 endosome to melanosome transport Biological Process

GO:0035654 clathrin-coated vesicle cargo loading, AP-3-mediated Biological Process

GO:0048007 antigen processing and presentation, exogenous lipid antigen via MHC class Ib Biological Process

KEGG gene cross-reference

ath:AT1G48760

bta:281023

ddi:DDB_G0279537

hsa:8943

mmu:11776

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · TkAUNG073270 · TK1151

Nucleus0.331

Rank 2 · TkAUNG073270 · TK1151

Golgi apparatus0.129

Rank 3 · TkAUNG073270 · TK1151

Cell membrane0.099

Rank 4 · TkAUNG073270 · TK1151

Lysosome / Vacuole0.095

Rank 5 · TkAUNG073270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C744`	Arabidopsis thaliana	sp\|Q9C744\|AP3D_ARATH AP-3 complex subunit delta	45.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card