TkAUNG067460 | RubberDandelionOmics

Gene overview

TkAUNG067460

Reference: TK1151 Chr: ChrUn Coordinates: 19587404-19594072 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2000 bp · TkAUNG067460|TK1151|cDNA

ACAGTATTTTACAAAAGTATTAATTTTTGTTTTTAAAGGAAAAGAAAATTAGAAGAAATTTTTTTTTTCTTAATCGTGAGTTTGTGAATCATTGTGATAATGTGATGTTTTGAGTTTCAACCGACCCGGCCCGTTCTATGTACTCCTCTAACCTAAGTCTGCATCACTTCCAAAACTGCTTTCGTCTCTGTTGGAGGTGGCAATGGAGGGAGACGGAGAAGTAATCAGAGAAAAAACGAGGATATACGTTGGTGGACTGG...

CDS

Download CDS FASTA

1410 bp · TkAUNG067460|TK1151|CDS

ATGGAGGGAGACGGAGAAGTAATCAGAGAAAAAACGAGGATATACGTTGGTGGACTGGGTGGCGCTGTGACGGAGGACGATCTCAGGAAAACTTTCTCGGCGTTGGGTGAAGTAGTCTCTGTTGATGTTGTTCGCACGAAAGACCGTAGCTTTGCTTACCTCGACTTCCTTCCTTCTTCCGATAAATCTCTTCCAAAGCTCTTTAGCACGTATAATGGATGTATGTGGAAAGGAGGGAAGCTGCGACTTGAGAAGGCTAA...

Protein

Download Protein FASTA

469 aa · TkAUNG067460|TK1151|PROTEIN

MEGDGEVIREKTRIYVGGLGGAVTEDDLRKTFSALGEVVSVDVVRTKDRSFAYLDFLPSSDKSLPKLFSTYNGCMWKGGKLRLEKAKEHYLEKMRREWEEESKLASKPVPSDSLETDDNALKKPTKPSSEINKQLCLFFPKLGKVKSLGQVGIGKHKYSFQRIQVPPIPTHFCDCEEHSIDFSPPNKNKASEIEKACDGVNEQEVNIMNSVMNKIFERANPSKKVDEDNLTDEDNLIINVGNGSDGMDLVGEMRSMMANQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG067460`
TK1151 ID	TkAUNG067460
OH-1004 ID	LXL04_003007
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.200
Protein coverage (%)	TK1151 96.162 / OH-1004 72.831 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG067460

Location ChrUn:19587404-19594072 (+)

Description Similar to ROS3: Protein REPRESSOR OF SILENCING 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58130`	RNA-binding protein required for DNA demethylation and to eluviate siRNA-mediated transcriptional gene silencing (TGS), probably by guiding ROS1.	ROS3 is an RNA-binding protein required for DNA demethylation in Arabidopsis.2008 · DOI: 10.1038/nature07305

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003007 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0060966 regulation of gene silencing by regulatory ncRNA Biological Process

GO:1902570 protein localization to nucleolus Biological Process

GO:1990830 cellular response to leukemia inhibitory factor Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003727 single-stranded RNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G58130

hsa:55035

mmu:70930

spo:2541269

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · TkAUNG067460 · TK1151

Cytoplasm0.082

Rank 2 · TkAUNG067460 · TK1151

Cell membrane0.023

Rank 3 · TkAUNG067460 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkAUNG067460 · TK1151

Plastid0.008

Rank 5 · TkAUNG067460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367RRM_713-39 aa

PF00076RRM_114-56 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG067460	`PF16367`	RRM_7	13	39	0.051	14.3
TkAUNG067460	`PF00076`	RRM_1	14	56	1e-07	32.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGT1`	Arabidopsis thaliana	sp\|Q9FGT1\|ROS3_ARATH Protein REPRESSOR OF SILENCING 3	50.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card