Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1407 bp · TkAUNG061170|TK1151|cDNA
ATGAATTTCCCTGCTCTATTACTCTTTCTACTCATCTTTTCCTATAGCCGAGTTCAATCCGATGAAGAAGGATATATCACGGCAGAAATATCAAACAAAGGCCTCGATTTTCTCAAGGATTTGCTGATACAAGAAGCGGAGTCTTCATTAGTCCCACTTGAGCTTCCCGAGATTGAAAAGTCTGTGAAAATTCCAGTTGTCGGTACTGTTCAAATTGCTCTTTCCAATATTGTAATTGAAAGCATCCACGTGACGTCGTC...
1407 bp · TkAUNG061170|TK1151|CDS
ATGAATTTCCCTGCTCTATTACTCTTTCTACTCATCTTTTCCTATAGCCGAGTTCAATCCGATGAAGAAGGATATATCACGGCAGAAATATCAAACAAAGGCCTCGATTTTCTCAAGGATTTGCTGATACAAGAAGCGGAGTCTTCATTAGTCCCACTTGAGCTTCCCGAGATTGAAAAGTCTGTGAAAATTCCAGTTGTCGGTACTGTTCAAATTGCTCTTTCCAATATTGTAATTGAAAGCATCCACGTGACGTCGTC...
Protein
Download Protein FASTA468 aa · TkAUNG061170|TK1151|PROTEIN
MNFPALLLFLLIFSYSRVQSDEEGYITAEISNKGLDFLKDLLIQEAESSLVPLELPEIEKSVKIPVVGTVQIALSNIVIESIHVTSSTVRTGDSGIVIDVSGATANLSMHWKYSYSTWVLIPISVSDEGNATIQVEGMEVGLTLSLETVEGSLKVPLLECGCYVNDISIKLDGGASWLYQGLVDAFGDKIGSAVEDAIPKKIKDAMVKLDSLLQSLPKEIPVTSVASLNITLVEEPKLSESSVDVAIDGLFSAKHEVALP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG061170 |
|---|---|
| TK1151 ID | TkAUNG061170 |
| OH-1004 ID | LXL04_031012 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 49.600 |
| Protein coverage (%) | TK1151 96.581 / OH-1004 92.008Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG061170 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:17795322-17799916 (+) | |||||||||
| Description | Similar to At1g04970: Putative BPI/LBP family protein At1g04970 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0010468 regulation of gene expression Biological Process GO:0031663 lipopolysaccharide-mediated signaling pathway Biological Process GO:0032715 negative regulation of interleukin-6 production Biological Process GO:0032717 negative regulation of interleukin-8 production Biological Process GO:0032720 negative regulation of tumor necrosis factor production Biological Process GO:0042742 defense response to bacterium Biological Process GO:0045087 innate immune response Biological Process GO:0050829 defense response to Gram-negative bacterium Biological Process GO:1903409 reactive oxygen species biosynthetic process Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005576 extracellular region Cellular Component GO:0005615 extracellular space Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G04970 ath:AT3G20270 hsa:671 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01273LBP_BPI_CETP34-210 aaPF02886LBP_BPI_CETP_C223-458 aaPF23252KH_PARP14_5226-255 aaPF23252KH_PARP14_5309-332 aaPF23252KH_PARP14_5380-401 aaPF01273LBP_BPI_CETP402-447 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG061170 | PF01273 | LBP_BPI_CETP | 34 | 210 | 4.3e-24 | 85.8 |
| TkAUNG061170 | PF02886 | LBP_BPI_CETP_C | 223 | 458 | 1.2e-30 | 107.6 |
| TkAUNG061170 | PF23252 | KH_PARP14_5 | 226 | 255 | 0.24 | 12.3 |
| TkAUNG061170 | PF23252 | KH_PARP14_5 | 309 | 332 | 0.24 | 12.3 |
| TkAUNG061170 | PF23252 | KH_PARP14_5 | 380 | 401 | 0.24 | 12.3 |
| TkAUNG061170 | PF01273 | LBP_BPI_CETP | 402 | 447 | 4.3e-24 | 85.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.