TkAUNG060600 | RubberDandelionOmics

Gene overview

TkAUNG060600

Reference: TK1151 Chr: ChrUn Coordinates: 17623719-17625587 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · TkAUNG060600|TK1151|cDNA

GAAGTTCTTTGAGGCATCTTCAACTACTCGTCATATGCGTTAGAAATTCCCTTACTATAATTGGCGTATTACAAACATACATGATACATATCCAATAAATTTGAGTTTTTTTTAGTGGACAAACTAACTAAAAGAGAAATTGAGAAAACAAATTCGAAAATAAAATTGGTATCACTATCCGCCCCATCGGACTCCTCTGCTAATTTGATTCAAAAATAGTCTCATGAGCGGCGAAGAAACGGAGTATCACTCCAAGGATT...

CDS

Download CDS FASTA

924 bp · TkAUNG060600|TK1151|CDS

ATGAGCGGCGAAGAAACGGAGTATCACTCCAAGGATTTCGACTGGGAGGAGCTTCGGCAACGCGTTGAGGACGATCCTGCCCTTCGGTATCACCTTCTTCCCTTTACTCATCAATCATTATCTTCATCTGCCCTAGACTCACAATCATGGAACCACTTTCACGCTCGTCACTCCACCGGAAAATTCTTCAAGGAGAGACGGTATCTGTTCAAGGAATTTCCTGAATTAGCTTCTTGCGGGGAGCATTCAAAGGTACTTGA...

Protein

Download Protein FASTA

307 aa · TkAUNG060600|TK1151|PROTEIN

MSGEETEYHSKDFDWEELRQRVEDDPALRYHLLPFTHQSLSSSALDSQSWNHFHARHSTGKFFKERRYLFKEFPELASCGEHSKVLEAGCGNGSTALPILRGKENITVYACDCSTEALERATEIIYASNVVLDKSRFRPFCCDFSTSQFPKWLICDSCRETSLQKDFDNHKRDIVTSSKESECCIGGVDYVTLIFTLSAVPLDRMSLAVTECFSVLKPGGLLFFRDYGLYDMTMLRFEADQRVGFREYKRSDGTRSYFFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG060600`
TK1151 ID	TkAUNG060600
OH-1004 ID	LXL04_023609
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	67.600
Protein coverage (%)	TK1151 31.270 / OH-1004 73.944 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG060600`
Location	ChrUn:17623719-17625587 (-)
Description	Similar to METTL6: tRNA N(3)-methylcytidine methyltransferase METTL6
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023609` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006400 tRNA modification Biological Process GO:0030488 tRNA methylation Biological Process GO:0032259 methylation Biological Process GO:0106217 tRNA C3-cytosine methylation Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0043527 tRNA methyltransferase complex Cellular Component GO:0008173 RNA methyltransferase activity Molecular Function GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0019899 enzyme binding Molecular Function GO:0052735 tRNA (cytidine-3-)-methyltransferase activity Molecular Function
KEGG gene cross-reference	ddi:DDB_G0274197 hsa:131965 mmu:67011 pon:100171853 rno:290564 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.639

Rank 1 · TkAUNG060600 · TK1151

Cytoplasm0.509

Rank 2 · TkAUNG060600 · TK1151

Mitochondrion0.077

Rank 3 · TkAUNG060600 · TK1151

Cell membrane0.027

Rank 4 · TkAUNG060600 · TK1151

Endoplasmic reticulum0.020

Rank 5 · TkAUNG060600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30764DUF87249-92 aa

PF10017Methyltransf_3365-146 aa

PF13489Methyltransf_2366-273 aa

PF05175MTS70-129 aa

PF01739CheR80-143 aa

PF01209Ubie_methyltran80-123 aa

PF13847Methyltransf_3182-228 aa

PF13649Methyltransf_2585-146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG060600	`PF30764`	DUF8724	9	92	0.22	12.2
TkAUNG060600	`PF10017`	Methyltransf_33	65	146	0.018	14.8
TkAUNG060600	`PF13489`	Methyltransf_23	66	273	2.3e-13	50.9
TkAUNG060600	`PF05175`	MTS	70	129	0.00078	19.8
TkAUNG060600	`PF01739`	CheR	80	143	0.0032	17.6
TkAUNG060600	`PF01209`	Ubie_methyltran	80	123	0.032	14.3
TkAUNG060600	`PF13847`	Methyltransf_31	82	228	7.3e-07	29.8
TkAUNG060600	`PF13649`	Methyltransf_25	85	146	3.3e-10	41.2
TkAUNG060600	`PF08242`	Methyltransf_12	86	222	8.6e-10	39.9
TkAUNG060600	`PF08241`	Methyltransf_11	86	130	2e-08	35.4
TkAUNG060600	`PF30764`	DUF8724	143	179	0.22	12.2
TkAUNG060600	`PF01209`	Ubie_methyltran	183	227	0.032	14.3
TkAUNG060600	`PF13649`	Methyltransf_25	188	220	3.3e-10	41.2
TkAUNG060600	`PF08241`	Methyltransf_11	188	224	2e-08	35.4
TkAUNG060600	`PF10017`	Methyltransf_33	235	274	0.018	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card