RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG059740
Reference: TK1151 Chr: ChrUn Coordinates: 17421025-17423496 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1905 bp · TkAUNG059740|TK1151|cDNA

AACACTACATATACCCCTCCACCCTCCTCTCAACTTCATCACCAGAATCTCATAACAGATTCACACACCAAAAAGCAACACAAAGTCAAAACAACATTTTATCCATCAAAAACCCAAATCATTAATAACAAAATGATAATGGATGAAAAAGCTGCATCAAACTACCAACAAGGCTTTGAAATCTCCGGCGATTTCACTTCTCAACACCCCACCAAATCCTTAGACGACGACGGCCGTCCCAAAAGGACAGGGACACTTGT...

CDS

Download CDS FASTA

1587 bp · TkAUNG059740|TK1151|CDS

AACACTACATATACCCCTCCACCCTCCTCTCAACTTCATCACCAGAATCTCATAACAGATTCACACACCAAAAAGCAACACAAAGTCAAAACAACATTTTATCCATCAAAAACCCAAATCATTAATAACAAAATGATAATGGATGAAAAAGCTGCATCAAACTACCAACAAGGCTTTGAAATCTCCGGCGATTTCACTTCTCAACACCCCACCAAATCCTTAGACGACGACGGCCGTCCCAAAAGGACAGGGACACTTGT...

Protein

Download Protein FASTA

528 aa · TkAUNG059740|TK1151|PROTEIN

NTTYTPPPSSQLHHQNLITDSHTKKQHKVKTTFYPSKTQIINNKMIMDEKAASNYQQGFEISGDFTSQHPTKSLDDDGRPKRTGTLVSASAHIITAVIGSGVLALAWSTAQLGWVAGPTVLFLFSFVTYYCSCLLASCYRTGDPVTGKRNYTYSEAVRSNLGGFKFKICGFIQYFNLAGTTIGYTIAASISMMAIKRSSCFHEKGHDSPCGINGTPFMLLFGAVEILLSQIPNFHEISWLSMVAAVMSFTYSAIGLGLGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG059740
TK1151 IDTkAUNG059740
OH-1004 IDLXL04_035885
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 91.667 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG059740
LocationChrUn:17421025-17423496 (+)
DescriptionSimilar to AAP2: Amino acid permease 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g77380 Amino acid-proton symporter.
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
At5g63850 Amino acid-proton symporter.
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
At5g09220 Amino acid-proton symporter.
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
Differential expression of two related amino acid transporters with differing substrate specificity in Arabidopsis thaliana.1993 · DOI: 10.1046/j.1365-313x.1993.04060993.x
At1g44100 Amino acid-proton symporter.
Root uptake of cationic amino acids by Arabidopsis depends on functional expression of amino acid permease 5.2008 · DOI: 10.1111/j.1469-8137.2008.02589.x
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
At1g58360 Amino acid-proton symporter.
AAP1 transports uncharged amino acids into roots of Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03045.x
AAP1 regulates import of amino acids into developing Arabidopsis embryos.2009 · DOI: 10.1111/j.1365-313x.2009.03890.x
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.1995 · DOI: 10.1074/jbc.270.27.16315
Differential expression of two related amino acid transporters with differing substrate specificity in Arabidopsis thaliana.1993 · DOI: 10.1046/j.1365-313x.1993.04060993.x

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035885 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0003333 amino acid transmembrane transport Biological Process
GO:0006865 amino acid transport Biological Process
GO:0006952 defense response Biological Process
GO:0009624 response to nematode Biological Process
GO:0015800 acidic amino acid transport Biological Process
GO:0015802 basic amino acid transport Biological Process
GO:0015804 neutral amino acid transport Biological Process
GO:0015808 L-alanine transport Biological Process
GO:0043090 amino acid import Biological Process
GO:0098712 L-glutamate import across plasma membrane Biological Process
GO:0110126 phloem loading Biological Process
GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference
ath:AT1G44100
ath:AT1G58360
ath:AT1G77380
ath:AT5G09220
ath:AT5G63850
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.715
Rank 1 · TkAUNG059740 · TK1151
Lysosome / Vacuole0.128
Rank 2 · TkAUNG059740 · TK1151
Cytoplasm0.095
Rank 3 · TkAUNG059740 · TK1151
Endoplasmic reticulum0.093
Rank 4 · TkAUNG059740 · TK1151
Golgi apparatus0.049
Rank 5 · TkAUNG059740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01490Aa_trans83-515 aa
PF15957Comm114-143 aa
PF19616DUF6121153-197 aa
PF19616DUF6121304-382 aa
PF15957Comm330-350 aa
PF13572DUF4134375-390 aa
PF13572DUF4134441-462 aa
PF19616DUF6121489-507 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG059740PF01490Aa_trans835151.8e-118396.5
TkAUNG059740PF15957Comm1141430.4711.4
TkAUNG059740PF19616DUF61211531970.02715.0
TkAUNG059740PF19616DUF61213043820.02715.0
TkAUNG059740PF15957Comm3303500.4711.4
TkAUNG059740PF13572DUF41343753902.19.3
TkAUNG059740PF13572DUF41344414622.19.3
TkAUNG059740PF19616DUF61214895070.02715.0
TkAUNG059740PF13572DUF41344965252.19.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q39134Arabidopsis thalianasp|Q39134|AAP3_ARATH Amino acid permease 367.800%Swiss-ProtHigh
Q9FN04Arabidopsis thalianasp|Q9FN04|AAP4_ARATH Amino acid permease 470.700%Swiss-ProtHigh
Q38967Arabidopsis thalianasp|Q38967|AAP2_ARATH Amino acid permease 267.700%Swiss-ProtHigh
Q8GUM3Arabidopsis thalianasp|Q8GUM3|AAP5_ARATH Amino acid permease 564.200%Swiss-ProtHigh
Q42400Arabidopsis thalianasp|Q42400|AAP1_ARATH Amino acid permease 160.600%Swiss-ProtHigh

JBrowse

View in Genome Browser