Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1731 bp · TkAUNG059530|TK1151|cDNA
ATTTCACCATCTTTAAGAACATCAAAAAACCTCCAGAAAAAACTTAAATGCAGCATGGGGAAAACGAAGAAATGCTGTTTTGGATTATGTTTATTGACTTTAATACTTATAAATATATTATTAACCATAAATCTGTACGTAGGTAAAGGTGGAGGAGCATTACATGAGATTGTTTATCAGTCATCGTTGACTTGGAGTGAAAAAGCAGCTACGGAGGCGGAAGCGGTTGCAGCAATCTCATGTTCCGGCCATGGCAGAGC...
903 bp · TkAUNG059530|TK1151|CDS
ATGGGGAAAACGAAGAAATGCTGTTTTGGATTATGTTTATTGACTTTAATACTTATAAATATATTATTAACCATAAATCTGTACGTAGGTAAAGGTGGAGGAGCATTACATGAGATTGTTTATCAGTCATCGTTGACTTGGAGTGAAAAAGCAGCTACGGAGGCGGAAGCGGTTGCAGCAATCTCATGTTCCGGCCATGGCAGAGCTTACCTCGATAATTTCATTTCAGAAGGTCAAACTGTTTGCGAATGTAACGCTTG...
Protein
Download Protein FASTA300 aa · TkAUNG059530|TK1151|PROTEIN
MGKTKKCCFGLCLLTLILINILLTINLYVGKGGGALHEIVYQSSLTWSEKAATEAEAVAAISCSGHGRAYLDNFISEGQTVCECNACYGGFDCSEFSPDCSADADRGDPIFLEPFWMQNAPNSTVVVSGCHRMSYSYADNTMMSPEVEKYIRKLHSIVGNAITEGRYLVFGVGSTQLLNAAVYALASQNSFSPSNVVAQIPYFPTYKDQTVLFNSSDFQFGGDTTSWKSNNSANNMDVIEFVTSPNNPDGELKTSVLGGK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG059530 |
|---|---|
| TK1151 ID | TkAUNG059530 |
| OH-1004 ID | LXL04_009506 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 44.600 |
| Protein coverage (%) | TK1151 65.333 / OH-1004 43.681Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG059530 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:17335993-17344923 (+) | |||||||||
| Description | Similar to TAR2: Tryptophan aminotransferase-related protein 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006520 amino acid metabolic process Biological Process GO:0009641 shade avoidance Biological Process GO:0009684 indoleacetic acid biosynthetic process Biological Process GO:0009723 response to ethylene Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0009851 auxin biosynthetic process Biological Process GO:0009908 flower development Biological Process GO:0009926 auxin polar transport Biological Process GO:0009958 positive gravitropism Biological Process GO:0010078 maintenance of root meristem identity Biological Process GO:0010087 phloem or xylem histogenesis Biological Process GO:0010588 cotyledon vascular tissue pattern formation Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G23320 ath:AT1G70560 ath:AT4G24670 dosa:Os01g0169800 dosa:Os05g0169300 osa:4337930 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04863EGF_alliinase46-100 aaPF00155Aminotran_1_249-89 aaPF23106EGF_Teneurin63-95 aaPF04864Alliinase_C102-300 aaPF00155Aminotran_1_2143-251 aaPF00155Aminotran_1_2280-300 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG059530 | PF04863 | EGF_alliinase | 46 | 100 | 4.6e-26 | 91.7 |
| TkAUNG059530 | PF00155 | Aminotran_1_2 | 49 | 89 | 0.054 | 13.4 |
| TkAUNG059530 | PF23106 | EGF_Teneurin | 63 | 95 | 0.19 | 12.5 |
| TkAUNG059530 | PF04864 | Alliinase_C | 102 | 300 | 3.6e-81 | 273.6 |
| TkAUNG059530 | PF00155 | Aminotran_1_2 | 143 | 251 | 0.054 | 13.4 |
| TkAUNG059530 | PF00155 | Aminotran_1_2 | 280 | 300 | 0.054 | 13.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.