TkAUNG058050 | RubberDandelionOmics

Gene overview

TkAUNG058050

Reference: TK1151 Chr: ChrUn Coordinates: 16956300-16957190 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

729 bp · TkAUNG058050|TK1151|cDNA

CAACGTATTCAAAAAGCTTCACTCCAGTCACCAGGTATCTCCTCTAATGGAACTTCATCTTCACGGGGGATTTTCCGAGGTTTAAGCTTTAAAAAGAAGGATCATATTCCTCCTAATGGTGAAAGCAGCTCTCTTCTTCCTTCCGACTCAAATGCACCACCGCCTGAAAGCCCTCTTGTCCCCAACACCGCCTCCCATTTATATCGGAAACGCTGCACATCTCTTCCAGTCAAACACACATCAAATCCTTCTCCGTCAGC...

CDS

Download CDS FASTA

729 bp · TkAUNG058050|TK1151|CDS

CAACGTATTCAAAAAGCTTCACTCCAGTCACCAGGTATCTCCTCTAATGGAACTTCATCTTCACGGGGGATTTTCCGAGGTTTAAGCTTTAAAAAGAAGGATCATATTCCTCCTAATGGTGAAAGCAGCTCTCTTCTTCCTTCCGACTCAAATGCACCACCGCCTGAAAGCCCTCTTGTCCCCAACACCGCCTCCCATTTATATCGGAAACGCTGCACATCTCTTCCAGTCAAACACACATCAAATCCTTCTCCGTCAGC...

Protein

Download Protein FASTA

242 aa · TkAUNG058050|TK1151|PROTEIN

QRIQKASLQSPGISSNGTSSSRGIFRGLSFKKKDHIPPNGESSSLLPSDSNAPPPESPLVPNTASHLYRKRCTSLPVKHTSNPSPSATTPISARTYNEQQKSQIWAAQASVSRSLSVPGRNIVIVRSISFAARKDNDKIDSVDDEIGGVEVENDEEIDEEEAICRICFDPCDEGNQLKMECSCKGALRLVHEECAAKWFSVKGNKNCDVCGREVSNLPVTLLRFPCYVQRQHKINKLSIQEQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG058050`
TK1151 ID	TkAUNG058050
OH-1004 ID	LXL04_035866
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 90.083 / OH-1004 32.831 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG058050`
Location	ChrUn:16956300-16957190 (+)
Description	Similar to ACA8: Calcium-transporting ATPase 8, plasma membrane-type
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035866` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009409 response to cold Biological Process GO:0009414 response to water deprivation Biological Process GO:0009555 pollen development Biological Process GO:0009567 double fertilization forming a zygote and endosperm Biological Process GO:0009624 response to nematode Biological Process GO:0051480 regulation of cytosolic calcium ion concentration Biological Process GO:0005634 nucleus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component GO:0009536 plastid Cellular Component GO:0016020 membrane Cellular Component GO:0005388 P-type calcium transporter activity Molecular Function
KEGG gene cross-reference	ath:AT3G21180 ath:AT4G29900 ath:AT5G57110 dosa:Os04g0605500 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.388

Rank 1 · TkAUNG058050 · TK1151

Nucleus0.297

Rank 2 · TkAUNG058050 · TK1151

Cell membrane0.277

Rank 3 · TkAUNG058050 · TK1151

Endoplasmic reticulum0.097

Rank 4 · TkAUNG058050 · TK1151

Golgi apparatus0.093

Rank 5 · TkAUNG058050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03508Connexin4391-138 aa

PF12906RINGv164-210 aa

PF13639zf-RING_2164-210 aa

PF08746zf-RING-like180-210 aa

PF17120zf-RING_16182-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG058050	`PF03508`	Connexin43	91	138	0.011	16.7
TkAUNG058050	`PF12906`	RINGv	164	210	2.5e-14	53.8
TkAUNG058050	`PF13639`	zf-RING_2	164	210	0.0052	17.7
TkAUNG058050	`PF08746`	zf-RING-like	180	210	4.7	8.1
TkAUNG058050	`PF17120`	zf-RING_16	182	211	0.21	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card