TkAUNG057140 | RubberDandelionOmics

Gene overview

TkAUNG057140

Reference: TK1151 Chr: ChrUn Coordinates: 16297335-16302331 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1527 bp · TkAUNG057140|TK1151|cDNA

ATGAAAGATCAATTCCCCTGGGCGTGGAAGCAACGCAGAAAGAGAAGTGAAGCAAAGCGAAAAAGGGAGGAGAAGATTCTGCGTTTGATGCGTCCCCGAACCGGAGTCACGAATAATAGTGAGCTGATTTTCTTGTGTGAAGAATCTGATATTTTGTTGGTTGAGCCCATTGCTTCTTGTGTTGGAGAGTATGAGTTGATGAAAGAAAACAAGTCCAAAATGAGCATTTTACAACACTTGATTCCAACTGATTTTATAGT...

CDS

Download CDS FASTA

1527 bp · TkAUNG057140|TK1151|CDS

ATGAAAGATCAATTCCCCTGGGCGTGGAAGCAACGCAGAAAGAGAAGTGAAGCAAAGCGAAAAAGGGAGGAGAAGATTCTGCGTTTGATGCGTCCCCGAACCGGAGTCACGAATAATAGTGAGCTGATTTTCTTGTGTGAAGAATCTGATATTTTGTTGGTTGAGCCCATTGCTTCTTGTGTTGGAGAGTATGAGTTGATGAAAGAAAACAAGTCCAAAATGAGCATTTTACAACACTTGATTCCAACTGATTTTATAGT...

Protein

Download Protein FASTA

508 aa · TkAUNG057140|TK1151|PROTEIN

MKDQFPWAWKQRRKRSEAKRKREEKILRLMRPRTGVTNNSELIFLCEESDILLVEPIASCVGEYELMKENKSKMSILQHLIPTDFIVIDIGGWLMGEGNRRRIIKLCLPDGKHDVEAKKLIKKYKIAWGLQNRIHGAENRSIEGRTGRFVSTRVKQGWESAISADGGDTEIAIEVWRKLESLYQTKTLANRLFLKQKLIAFKILEEKRVLEKLDEFNKLIDDLSNIGEKQNEEDLALLLLNALPRSYQSFKDALIYGRMS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG057140`
TK1151 ID	TkAUNG057140
OH-1004 ID	LXL04_031346
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	34.800
Protein coverage (%)	TK1151 63.386 / OH-1004 15.399 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG057140`
Location	ChrUn:16297335-16302331 (-)
Description	Similar to Retrovirus-related Pol polyprotein from transposon TNT 1-94
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031346` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0071897 DNA biosynthetic process Biological Process GO:0042575 DNA polymerase complex Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.521

Rank 1 · TkAUNG057140 · TK1151

Nucleus0.300

Rank 2 · TkAUNG057140 · TK1151

Endoplasmic reticulum0.098

Rank 3 · TkAUNG057140 · TK1151

Cell membrane0.088

Rank 4 · TkAUNG057140 · TK1151

Mitochondrion0.076

Rank 5 · TkAUNG057140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_2169-283 aa

PF10719ComFB206-272 aa

PF30322AtMg00530246-288 aa

PF09422AMER272-355 aa

PF00098zf-CCHC325-342 aa

PF13696zf-CCHC_2326-342 aa

PF30322AtMg00530333-400 aa

PF22936Pol_BBD379-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG057140	`PF14223`	Retrotran_gag_2	169	283	4.7e-23	82.5
TkAUNG057140	`PF10719`	ComFB	206	272	0.14	12.9
TkAUNG057140	`PF30322`	AtMg00530	246	288	0.006	17.5
TkAUNG057140	`PF09422`	AMER	272	355	0.15	12.0
TkAUNG057140	`PF00098`	zf-CCHC	325	342	0.00038	21.1
TkAUNG057140	`PF13696`	zf-CCHC_2	326	342	0.00029	21.3
TkAUNG057140	`PF30322`	AtMg00530	333	400	0.006	17.5
TkAUNG057140	`PF22936`	Pol_BBD	379	459	6.6e-26	91.2
TkAUNG057140	`PF00098`	zf-CCHC	490	494	0.00038	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card