TkAUNG056270 | RubberDandelionOmics

Gene overview

TkAUNG056270

Reference: TK1151 Chr: ChrUn Coordinates: 16031738-16034569 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1672 bp · TkAUNG056270|TK1151|cDNA

AGGATAAATATTTAACTAAAAACTACAGTAAGGTGGACTGGAGTACTCTAATTTCCCGTGAAGCTCGGTGGCTATATGAAAGGGAGAGATAGGGAATCTCTCGGCTGAGAAATCGGTGGTTGCCGTCGTGGTGGTGGTGGTAGTGGAGTGAATATCACATCAGTGTTTCTTCGAAATATCCACTTCCAAAAGACCTCAATGCTCAGCTTCAAGTGAATAATTTGTCCTCCCATGGCGACGCAGCTCACTCACTCTCACTT...

CDS

Download CDS FASTA

1230 bp · TkAUNG056270|TK1151|CDS

ATGGCGACGCAGCTCACTCACTCTCACTTCTTCCTCCCTTCTTACAAACACTTCTTCGCTGACGCTCCAGAATCTCGCCTTTGTCGGTTCCCCGTTCGTCACCGCCGCAGCCTCCTCGTCGCAGATTGTGCTTCAACACCAACTGAATCAAGTGTTAGGGTTGCCGGTAGGAAACCGGCGAGGACCAATGCAGACCTCTGCAACGATTTACGGGAATTTATCTCCGATGCGGGGCTTCCAGACGGACATGTTCCTTCCTT...

Protein

Download Protein FASTA

409 aa · TkAUNG056270|TK1151|PROTEIN

MATQLTHSHFFLPSYKHFFADAPESRLCRFPVRHRRSLLVADCASTPTESSVRVAGRKPARTNADLCNDLREFISDAGLPDGHVPSLKELSQHGRQDLANLVRRRGYKLIKELLAASQELKVTDSDVDETLTDNQDKTSTEEDESTGLDDNETKLTEDSILLNEETSISKTFDDDTESNTESFFSVDSSPKPSLQEKVMNFIQNGELEAIEDSVNSPNGTILSTTQLRDISSNDQQLEDPESTNTVKEDEAEINRIKVML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG056270`
TK1151 ID	TkAUNG056270
OH-1004 ID	LXL04_005133
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	82.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG056270

Location ChrUn:16031738-16034569 (+)

Description Similar to PTST: Protein PTST homolog 3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03420`	Involved in starch granule initiation in leaf chloroplasts.	No verified direct reference in this release
`At5g39790`	Involved in targeting GBSS1 to the starch granule.	Arabidopsis At5g39790 encodes a chloroplast-localized, carbohydrate-binding, coiled-coil domain-containing putative scaffold protein.2008 · DOI: 10.1186/1471-2229-8-120
`At1g27070`	Involved in starch granule initiation in leaf chloroplasts.	Homologs of PROTEIN TARGETING TO STARCH Control Starch Granule Initiation in Arabidopsis Leaves.2017 · DOI: 10.1105/tpc.17.00222 Two Plastidial Coiled-Coil Proteins Are Essential for Normal Starch Granule Initiation in Arabidopsis.2018 · DOI: 10.1105/tpc.18.00219

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0686900`	Involved in compound starch granule formation and starch synthesis in endosperm.	FLOURY ENDOSPERM6 encodes a CBM48 domain-containing protein involved in compound granule formation and starch synthesis in rice endosperm.2014 · DOI: 10.1111/tpj.12444

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005133 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010581 regulation of starch biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G03420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.969

Rank 1 · TkAUNG056270 · TK1151

Nucleus0.041

Rank 2 · TkAUNG056270 · TK1151

Cytoplasm0.036

Rank 3 · TkAUNG056270 · TK1151

Mitochondrion0.030

Rank 4 · TkAUNG056270 · TK1151

Peroxisome0.024

Rank 5 · TkAUNG056270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00038Filament118-146 aa

PF14071YlbD_coat156-223 aa

PF14071YlbD_coat233-286 aa

PF00038Filament240-311 aa

PF20878REST_helical257-295 aa

PF16561AMPK1_CBM319-407 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG056270	`PF00038`	Filament	118	146	0.0042	17.5
TkAUNG056270	`PF14071`	YlbD_coat	156	223	3.9	8.5
TkAUNG056270	`PF14071`	YlbD_coat	233	286	3.9	8.5
TkAUNG056270	`PF00038`	Filament	240	311	0.0042	17.5
TkAUNG056270	`PF20878`	REST_helical	257	295	0.0017	19.2
TkAUNG056270	`PF16561`	AMPK1_CBM	319	407	1.1e-12	48.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KFB3`	Arabidopsis thaliana	sp\|F4KFB3\|PTST3_ARATH Protein PTST homolog 3, chloroplastic	54.500%	Swiss-Prot	Low
`Q94AX2`	Arabidopsis thaliana	sp\|Q94AX2\|PTST_ARATH Protein PTST, chloroplastic	40.200%	Swiss-Prot	Low
`Q9LFY0`	Arabidopsis thaliana	sp\|Q9LFY0\|PTST2_ARATH Protein PTST homolog 2, chloroplastic	29.900%	Swiss-Prot	Low
`Q10F03`	Oryza sativa subsp. japonica	sp\|Q10F03\|FLO6_ORYSJ Protein FLOURY ENDOSPERM 6, chloroplastic	32.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card