TkAUNG054700 | RubberDandelionOmics

Gene overview

TkAUNG054700

Reference: TK1151 Chr: ChrUn Coordinates: 15601424-15602152 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

690 bp · TkAUNG054700|TK1151|cDNA

ATGGAGAATTCAAGTCAACTTAACCAATTCTCATCATCTTCCATTTCTACCGATCCACCTTCCTCCTCCACGACAGCCACCGGAATTATAAGATATGGTTCGAAGGAGTACAGCAAGTCACAGAAAGGCTCAATTAGAGCTCGAAAAGGAAACAATGGCAATGAGGAAAAGAAACCGAGTGAAGAGCACCCCACCTACCGCGGTGTAAGAAAGCGTAGTTGGGGAAAATGGGTGTCGGAAATACGTGAGCCACGGAAGAA...

CDS

Download CDS FASTA

690 bp · TkAUNG054700|TK1151|CDS

ATGGAGAATTCAAGTCAACTTAACCAATTCTCATCATCTTCCATTTCTACCGATCCACCTTCCTCCTCCACGACAGCCACCGGAATTATAAGATATGGTTCGAAGGAGTACAGCAAGTCACAGAAAGGCTCAATTAGAGCTCGAAAAGGAAACAATGGCAATGAGGAAAAGAAACCGAGTGAAGAGCACCCCACCTACCGCGGTGTAAGAAAGCGTAGTTGGGGAAAATGGGTGTCGGAAATACGTGAGCCACGGAAGAA...

Protein

Download Protein FASTA

229 aa · TkAUNG054700|TK1151|PROTEIN

MENSSQLNQFSSSSISTDPPSSSTTATGIIRYGSKEYSKSQKGSIRARKGNNGNEEKKPSEEHPTYRGVRKRSWGKWVSEIREPRKKSRIWLGTFWTAEMAARAHDVAAIAIKGTSAYLNFPQLAHLLPQPATRSPKDIREAAAKAAAMTIAGEQDTQHSQSSEDTQDGGELESQETTASDDSDDTFFDLPDLSLHHSGFFTASSWQVVGGVDTNFRLGGEEPFVWEIY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG054700`
TK1151 ID	TkAUNG054700
OH-1004 ID	LXL04_010444
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG054700

Location ChrUn:15601424-15602152 (-)

Description Similar to ERF034: Ethylene-responsive transcription factor ERF034

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60490`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At2g44940`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At4g16750`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At4g32800`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At5g25810`	Putative transcriptional activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010444 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G44940

ath:AT3G60490

ath:AT4G32800

ath:AT5G11590

ath:AT5G25810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · TkAUNG054700 · TK1151

Cytoplasm0.108

Rank 2 · TkAUNG054700 · TK1151

Cell membrane0.030

Rank 3 · TkAUNG054700 · TK1151

Endoplasmic reticulum0.023

Rank 4 · TkAUNG054700 · TK1151

Plastid0.018

Rank 5 · TkAUNG054700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11754Velvet25-202 aa

PF00847AP265-114 aa

PF00847AP2141-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG054700	`PF11754`	Velvet	25	202	0.061	14.1
TkAUNG054700	`PF00847`	AP2	65	114	7.2e-13	49.3
TkAUNG054700	`PF00847`	AP2	141	147	7.2e-13	49.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M210`	Arabidopsis thaliana	sp\|Q9M210\|ERF35_ARATH Ethylene-responsive transcription factor ERF035	48.800%	Swiss-Prot	Medium
`Q8LBQ7`	Arabidopsis thaliana	sp\|Q8LBQ7\|ERF34_ARATH Ethylene-responsive transcription factor ERF034	80.500%	Swiss-Prot	Low
`Q9SUK8`	Arabidopsis thaliana	sp\|Q9SUK8\|ERF39_ARATH Ethylene-responsive transcription factor ERF039	58.600%	Swiss-Prot	Medium
`Q9M080`	Arabidopsis thaliana	sp\|Q9M080\|ERF43_ARATH Ethylene-responsive transcription factor ERF043	68.800%	Swiss-Prot	Low
`Q39127`	Arabidopsis thaliana	sp\|Q39127\|TINY_ARATH Ethylene-responsive transcription factor TINY	70.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card