TkAUNG053660 | RubberDandelionOmics

Gene overview

TkAUNG053660

Reference: TK1151 Chr: ChrUn Coordinates: 15335034-15340348 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3092 bp · TkAUNG053660|TK1151|cDNA

ATGAAATCTAAAATTGTATTTTATCGCCAACGCACCCCTTTTTTATGAATCAATCTCTCTCTCTCTCTCTCTCTCCGTGTGAAACACACAATGACAACGGATCTTCTCCGGATATCTATACCACTTCAACCGAAGTCCACCACTTTCAGCCACCGCATTTTGACCTGCAATGCTGAATACAAACGGCATCGTGGTTATCTTTACCGGCCACCACCGCGTATCGTTCACAAACACCTTCCTAAGCCCCTCGTACTCGCCAA...

CDS

Download CDS FASTA

1875 bp · TkAUNG053660|TK1151|CDS

ATGCCACATTCTTTGATGAGCCGCATGCAGGTCATGCTTCTTGGTTTTGTTCTTTTGGGCCGTTCACTTGAAGAAAGGGCAAGGCTTAGGGCATCTAGTGACATGAATGAACTATTATCACTTATATCCACACAGTCACGACTAGTAATTTCTCCATCTGAAAGTGCTGATGTGGCAGTATCAGTATCATCTACTGGCACCATACTAAGCTCTGATTCAATCTGTATTGAAGTCCCTACTGATGACATTCGAGTTGGAGA...

Protein

Download Protein FASTA

624 aa · TkAUNG053660|TK1151|PROTEIN

MPHSLMSRMQVMLLGFVLLGRSLEERARLRASSDMNELLSLISTQSRLVISPSESADVAVSVSSTGTILSSDSICIEVPTDDIRVGDLVLVLPGETIPVDGKVMAGRSVVDESMLTGESLPVFKEQGLSVSAGTINWDGPLKIEASATGSNSTITKIVKMVEDAQGREAPIQRLADSIAGPFVYTVMTLSAATFAFWYYVGVHIFPDVLLNDISGPMENPLLLSLKLSTDVLVVSCPCALGLATPTAILVGTSLGAKQGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG053660`
TK1151 ID	TkAUNG053660
OH-1004 ID	LXL04_028528
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 96.955 / OH-1004 67.372 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG053660

Location ChrUn:15335034-15340348 (+)

Description Similar to PAA2: Copper-transporting ATPase PAA2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g21930`	Mediates copper transfer across the chloroplast thylakoid membrane.	No verified direct reference in this release
`At4g33520`	Mediates copper transfer across the plastid envelope.	Biochemical characterization of AtHMA6/PAA1, a chloroplast envelope Cu(I)-ATPase.2011 · DOI: 10.1074/jbc.m111.241034

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028528 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006825 copper ion transport Biological Process

GO:0009767 photosynthetic electron transport chain Biological Process

GO:0035434 copper ion transmembrane transport Biological Process

GO:0055070 copper ion homeostasis Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

KEGG gene cross-reference

ath:AT4G33520

ath:AT5G21930

ssp:SSP0297

syc:syc1785_d

syf:Synpcc7942_2317

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.251

Rank 1 · TkAUNG053660 · TK1151

Mitochondrion0.146

Rank 2 · TkAUNG053660 · TK1151

Cell membrane0.130

Rank 3 · TkAUNG053660 · TK1151

Cytoplasm0.122

Rank 4 · TkAUNG053660 · TK1151

Lysosome / Vacuole0.119

Rank 5 · TkAUNG053660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00122E1-E2_ATPase71-162 aa

PF00702Hydrolase274-506 aa

PF08282Hydrolase_3425-466 aa

PF08282Hydrolase_3480-527 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG053660	`PF00122`	E1-E2_ATPase	71	162	4.8e-28	97.7
TkAUNG053660	`PF00702`	Hydrolase	274	506	1.3e-25	91.6
TkAUNG053660	`PF08282`	Hydrolase_3	425	466	0.039	14.4
TkAUNG053660	`PF08282`	Hydrolase_3	480	527	0.039	14.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DFX7`	Arabidopsis thaliana	sp\|B9DFX7\|HMA8_ARATH Copper-transporting ATPase PAA2, chloroplastic	74.200%	Swiss-Prot	High
`Q9SZC9`	Arabidopsis thaliana	sp\|Q9SZC9\|HMA6_ARATH Copper-transporting ATPase PAA1, chloroplastic	43.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card