TkAUNG052730 | RubberDandelionOmics

Gene overview

TkAUNG052730

Reference: TK1151 Chr: ChrUn Coordinates: 15080298-15083645 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1371 bp · TkAUNG052730|TK1151|cDNA

ATGATCATCAGAAATGACACTCAATTTGCTGACGATGGTCCTCAGCCTTATGGTCATATCAGGTTGGGTAGGAAACGTTATGCCAACAAATATGGAGATAGATCTAGCATAAAAATGTGGGGTTATGATTTCGAAACCAAATTGTGGGTGGTCAGAAGAAACAGTGGAAGAATTGAGCACTACGACAAAATGGTCGATTTCCACGCGTGGACCTCAGTTGATCTAGCTGAGTTAGTTAGAGCTCCGTTTCTCAATCCTTA...

CDS

Download CDS FASTA

1371 bp · TkAUNG052730|TK1151|CDS

ATGATCATCAGAAATGACACTCAATTTGCTGACGATGGTCCTCAGCCTTATGGTCATATCAGGTTGGGTAGGAAACGTTATGCCAACAAATATGGAGATAGATCTAGCATAAAAATGTGGGGTTATGATTTCGAAACCAAATTGTGGGTGGTCAGAAGAAACAGTGGAAGAATTGAGCACTACGACAAAATGGTCGATTTCCACGCGTGGACCTCAGTTGATCTAGCTGAGTTAGTTAGAGCTCCGTTTCTCAATCCTTA...

Protein

Download Protein FASTA

456 aa · TkAUNG052730|TK1151|PROTEIN

MIIRNDTQFADDGPQPYGHIRLGRKRYANKYGDRSSIKMWGYDFETKLWVVRRNSGRIEHYDKMVDFHAWTSVDLAELVRAPFLNPYDVSSARGFRDFLTYQAFKGFSGFKTVESILKRAREHDIKKLARTQILTPYDDIFEIAAKEYTAFAAKIVRQRIPNRRLPVAEARINTISRLPVAEARIDATCDCDYDLRLRLLHPPFSQPVQATTIASSHSEFMDSNTPMDDVNNANRDDDDDDGDCVEIDDVGAGQLKKTGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG052730`
TK1151 ID	TkAUNG052730
OH-1004 ID	LXL04_000470
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	49.200
Protein coverage (%)	TK1151 54.167 / OH-1004 86.289 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG052730

Location ChrUn:15080298-15083645 (+)

Description Similar to Os03g0733400: Zinc finger BED domain-containing protein RICESLEEPER 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42170`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os01g0518400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000470 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032196 transposition Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G42170

dosa:Os03g0733400

dosa:Os05g0239150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.880

Rank 1 · TkAUNG052730 · TK1151

Cytoplasm0.182

Rank 2 · TkAUNG052730 · TK1151

Cell membrane0.025

Rank 3 · TkAUNG052730 · TK1151

Endoplasmic reticulum0.020

Rank 4 · TkAUNG052730 · TK1151

Mitochondrion0.018

Rank 5 · TkAUNG052730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05285SDA1_dom118-138 aa

PF07015VirC1132-185 aa

PF05285SDA1_dom231-259 aa

PF05699Dimer_Tnp_hAT336-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG052730	`PF05285`	SDA1_dom	118	138	3.9	8.6
TkAUNG052730	`PF07015`	VirC1	132	185	0.0017	18.5
TkAUNG052730	`PF05285`	SDA1_dom	231	259	3.9	8.6
TkAUNG052730	`PF05699`	Dimer_Tnp_hAT	336	418	5.3e-26	91.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2N5`	Arabidopsis thaliana	sp\|Q9M2N5\|DSLE_ARATH Zinc finger BED domain-containing protein DAYSLEEPER	39.400%	Swiss-Prot	Low
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	43.700%	Swiss-Prot	Low
`Q0JMB2`	Oryza sativa subsp. japonica	sp\|Q0JMB2\|RSLE4_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 4	40.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card