TkAUNG051940 | RubberDandelionOmics

Gene overview

TkAUNG051940

Reference: TK1151 Chr: ChrUn Coordinates: 14860515-14862557 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · TkAUNG051940|TK1151|cDNA

AAAAAGTCCATGTGTAAGGACTGAAATGAGCATAACTCATGTTTTAAGGGGCTGCTGCTGCTTCCCTTCCGATTCCTTTTCAGCTAAAAACCCTACCGTCGTCACTCAACCCTGTAACGGCCGAAACCCCCCTTCTTTTTTCCATGGTTTCTCGATATCGAGCTCAACAAATTCAATGATCATCATCATCAGCTCTACTGTTTTTCTTTAAAATCGAATATCCGATCATACATTCGCCCAACCATGGCCGCCGTATCGAG...

CDS

Download CDS FASTA

945 bp · TkAUNG051940|TK1151|CDS

ATGGCCGCCGTATCGAGAGGCCTCATTTCTTATCTCCGTAATTTATCGATTAATCCTCAGCGAACCCTTTCAACACCCATAACCAATCAGTTTTTGAGAAGCTTCAGCTCGGATGTATTGGTCAATGAAGGTGAAAGTTATAGTAACAACCGAATCATTGAAGCTAGGTCGAGAGTAATGACGCCCAATTCAAGAAGGACTGGAGTTATCGCTGTGAAATGTGGAATGACGGCTCTTTGGGACAAATGGGGAGCCAGGGT...

Protein

Download Protein FASTA

314 aa · TkAUNG051940|TK1151|PROTEIN

MAAVSRGLISYLRNLSINPQRTLSTPITNQFLRSFSSDVLVNEGESYSNNRIIEARSRVMTPNSRRTGVIAVKCGMTALWDKWGARVPITVLWLDENIVSQVKTPEKEGITALQIGCGHKKEKHLTKPEVGHFRAQGVPLKRKLREFPVTEDALLPLGTQIGVRHFVPGQYVDVTGITKGKGFQGAMKRWGFKGGPASHGASLSHRSPGSTGQRDAPGKVFKGKKMPGRMGGKQRTVKNVWVYKIDPARNLMWVRGQVPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG051940`
TK1151 ID	TkAUNG051940
OH-1004 ID	LXL04_015337
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG051940

Location ChrUn:14860515-14862557 (-)

Description Similar to RPL3B: 50S ribosomal protein L3-2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17465`	One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015337 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005762 mitochondrial large ribosomal subunit Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

GO:0019843 rRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G17465

gbe:GbCGDNIH1_0554

gox:GOX0380

nar:Saro_1249

zmo:ZMO0517

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.898

Rank 1 · TkAUNG051940 · TK1151

Plastid0.034

Rank 2 · TkAUNG051940 · TK1151

Cytoplasm0.033

Rank 3 · TkAUNG051940 · TK1151

Nucleus0.024

Rank 4 · TkAUNG051940 · TK1151

Extracellular0.007

Rank 5 · TkAUNG051940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00297Ribosomal_L351-85 aa

PF00297Ribosomal_L3164-247 aa

PF00297Ribosomal_L3250-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG051940	`PF00297`	Ribosomal_L3	51	85	9e-20	71.7
TkAUNG051940	`PF00297`	Ribosomal_L3	164	247	9e-20	71.7
TkAUNG051940	`PF00297`	Ribosomal_L3	250	274	9e-20	71.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRN8`	Arabidopsis thaliana	sp\|Q9LRN8\|RK3B_ARATH Large ribosomal subunit protein uL3m	73.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card