RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG046850
Reference: TK1151 Chr: ChrUn Coordinates: 12946222-12953982 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4358 bp · TkAUNG046850|TK1151|cDNA

TTGACTCGTCGATGGTTCATCCTTCTTGTCCTAATAAAATTACATTATAAAATGTCATTACTTTAATCATCATTGCAGCTTCAGGTCTCCTTCTTGTCCTGTACGCAGGTTACGGTGAAGGCATATTGTTACAAGTTACTTTCACATGCTACTCGTCAATTTCATATGATGAGTCATAAACTACACCAACATCGATCATTTCTTGATCTTATTAACAGTTGCATATTGTAAATGTTAATAATATGGATTTTATGTAGAGG...

CDS

Download CDS FASTA

3408 bp · TkAUNG046850|TK1151|CDS

ATGGTTGTTCTCTCCGAACTCATCTTAGAAGAATCTTCATCTACTTCATCAACTCATGTTCATAGTTCATCAACTCACGGTCATAGTTCATTAACTAATACGCCTAGCTACGATGTATACTTAAGTTTTAGGGATCTTGACACTCGTCATGGTTTCATATATGACCTTTATGAGGCCCTTATTGATGCAAATATCACTACTTTTTTGGACGATGAAGAGATTAAAACCGGGGAAGATCTGAAACCGGAATTGGAGAGTGC...

Protein

Download Protein FASTA

1135 aa · TkAUNG046850|TK1151|PROTEIN

MVVLSELILEESSSTSSTHVHSSSTHGHSSLTNTPSYDVYLSFRDLDTRHGFIYDLYEALIDANITTFLDDEEIKTGEDLKPELESAIKASRAFIIVLSKNYASSTWCLDELALILEQRIVSNHIIIPIFYHVQPSDVRWQEGSFGDAMAKYKQTMEVEIDANERSQWAVKMGRCNKALIEVANLKGKDVKGRRETEFIQEIVKDIYSRLHVPLRTLRPQLIGMESSIKFITSWLKDGSSHRADILTILGISGIGKTSLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG046850
TK1151 IDTkAUNG046850
OH-1004 IDLXL04_033813
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)96.700
Protein coverage (%)TK1151 100.000 / OH-1004 93.909
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG046850
LocationChrUn:12946222-12953982 (+)
DescriptionSimilar to RUN1: Disease resistance protein RUN1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g12010 TIR-NB-LRR receptor-like protein involved in plant defense.
Matching NLR Immune Receptors to Autoimmunity in camta3 Mutants Using Antimorphic NLR Alleles.2017 · DOI: 10.1016/j.chom.2017.03.005
At1g63880 TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Leptosphaeria maculans (blackleg disease).
Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans, causal agent of blackleg disease.2006 · DOI: 10.1111/j.1365-313x.2006.02688.x
At1g64070 TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Leptosphaeria maculans (blackleg disease).
Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans, causal agent of blackleg disease.2006 · DOI: 10.1111/j.1365-313x.2006.02688.x
At1g72930 Disease resistance protein. No verified direct reference in this release
At4g16950 TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Hyaloperonospora arabidopsis isolate Noco2 (downy mildew disease). No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_033813 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007165 signal transduction Biological Process
GO:0019677 NAD+ catabolic process Biological Process
GO:0043068 positive regulation of programmed cell death Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0003953 NAD+ nucleosidase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0042803 protein homodimerization activity Molecular Function
GO:0043531 ADP binding Molecular Function
KEGG gene cross-reference
ath:AT1G63880
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.376
Rank 1 · TkAUNG046850 · TK1151
Cell membrane0.340
Rank 2 · TkAUNG046850 · TK1151
Nucleus0.323
Rank 3 · TkAUNG046850 · TK1151
Endoplasmic reticulum0.081
Rank 4 · TkAUNG046850 · TK1151
Plastid0.046
Rank 5 · TkAUNG046850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01582TIR37-211 aa
PF13676TIR_239-135 aa
PF00931NB-ARC63-106 aa
PF08937ThsB_TIR72-117 aa
PF13191AAA_16221-343 aa
PF01637ATPase_2225-343 aa
PF00931NB-ARC227-384 aa
PF24883NPHP3_N232-273 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG046850PF01582TIR372117.5e-42143.8
TkAUNG046850PF13676TIR_2391356.4e-1762.9
TkAUNG046850PF00931NB-ARC631068.4e-1349.0
TkAUNG046850PF08937ThsB_TIR721170.1213.5
TkAUNG046850PF13191AAA_162213437.1e-0524.1
TkAUNG046850PF01637ATPase_22253431.3e-0629.2
TkAUNG046850PF00931NB-ARC2273848.4e-1349.0
TkAUNG046850PF24883NPHP3_N2322730.01816.0
TkAUNG046850PF13401AAA_222423431.2e-0629.6
TkAUNG046850PF20720nSTAND32442810.01615.6
TkAUNG046850PF05729NACHT2463980.001718.9
TkAUNG046850PF13855LRR_82893090.003717.7
TkAUNG046850PF08937ThsB_TIR2953330.1213.5
TkAUNG046850PF20720nSTAND33553740.01615.6
TkAUNG046850PF23282WHD_ROQ14745455.8e-1865.5
TkAUNG046850PF13676TIR_25085806.4e-1762.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SZ66Arabidopsis thalianasp|Q9SZ66|DSC1_ARATH Disease resistance-like protein DSC126.900%Swiss-ProtLow
Q9CAK1Arabidopsis thalianasp|Q9CAK1|RLM1B_ARATH Disease resistance protein RML1B28.300%Swiss-ProtLow
F4I594Arabidopsis thalianasp|F4I594|RLM1A_ARATH Disease resistance protein RML1A29.500%Swiss-ProtLow
Q9SSN3Arabidopsis thalianasp|Q9SSN3|TIR_ARATH Toll/interleukin-1 receptor-like protein40.500%Swiss-ProtMedium
F4JNB7Arabidopsis thalianasp|F4JNB7|RPP5_ARATH Disease resistance protein RPP539.000%Swiss-ProtMedium

JBrowse

View in Genome Browser