TkAUNG044890 | RubberDandelionOmics

Gene overview

TkAUNG044890

Reference: TK1151 Chr: ChrUn Coordinates: 12483784-12487078 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2972 bp · TkAUNG044890|TK1151|cDNA

AGGGTTTTAAGCTGTGCCGAAGGTTTTTGTTATGCTCACCGAGCTTCATTCGACGGAAGGGGATGGTTGAACACACACGGTGACACGCAAAAACCGCCTCCACCATGAAACCTCTCTCTTCCATCACCATCTTCCTCTGTTCTTCCTCACGCCGTCTCTTAGCCCGTACAACACCACTACCGTTTCTCAATTATGAAGCTGAAAAACTCGTCGGTATCTCCCATTTCTCAACCTCATCGTTGGACTCCCCAGCCTCCTCT...

CDS

Download CDS FASTA

2574 bp · TkAUNG044890|TK1151|CDS

ATGAAACCTCTCTCTTCCATCACCATCTTCCTCTGTTCTTCCTCACGCCGTCTCTTAGCCCGTACAACACCACTACCGTTTCTCAATTATGAAGCTGAAAAACTCGTCGGTATCTCCCATTTCTCAACCTCATCGTTGGACTCCCCAGCCTCCTCTTCCTATCATTCATCTTCAAGACGCAATCATGAGGATGTTAGAAACGTCAGGGTTTCCGTGTGGTGGGACTTCGAGAACTGCTCGATACCTTGTAACGTCAACGT...

Protein

Download Protein FASTA

857 aa · TkAUNG044890|TK1151|PROTEIN

MKPLSSITIFLCSSSRRLLARTTPLPFLNYEAEKLVGISHFSTSSLDSPASSSYHSSSRRNHEDVRNVRVSVWWDFENCSIPCNVNVYKVTQCITAAVRSVGIKGPIQITAFGDVLQLSRSNQEALSSTGINLTHIPNGGKNSADRSLLVDLMYWISQNPPPAHLLLISGDRDFASILHRLRMNNYNILLASTDNAPAVLCSAASIMWQWPAIIKGENQNGKHFNQPPDGPYASWYGHYKVQLEDPFAVSNQTSWMQSEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG044890`
TK1151 ID	TkAUNG044890
OH-1004 ID	LXL04_001288
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG044890`
Location	ChrUn:12483784-12487078 (-)
Description	Similar to MARF1: Meiosis regulator and mRNA stability factor 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001288` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006302 double-strand break repair Biological Process GO:0007143 female meiotic nuclear division Biological Process GO:0010468 regulation of gene expression Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0005737 cytoplasm Cellular Component GO:0005777 peroxisome Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0016020 membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0004540 RNA nuclease activity Molecular Function GO:1905762 CCR4-NOT complex binding Molecular Function
KEGG gene cross-reference	hsa:9665 mmu:223989 rno:170946 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.389

Rank 1 · TkAUNG044890 · TK1151

Cytoplasm0.337

Rank 2 · TkAUNG044890 · TK1151

Plastid0.161

Rank 3 · TkAUNG044890 · TK1151

Cell membrane0.159

Rank 4 · TkAUNG044890 · TK1151

Endoplasmic reticulum0.087

Rank 5 · TkAUNG044890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01936NYN69-205 aa

PF08784RPA_C259-306 aa

PF12872OST-HTH269-336 aa

PF24359DUF7515270-300 aa

PF01936NYN283-315 aa

PF08784RPA_C467-470 aa

PF14418OHA555-614 aa

PF12872OST-HTH643-702 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG044890	`PF01936`	NYN	69	205	5.2e-29	102.3
TkAUNG044890	`PF08784`	RPA_C	259	306	0.028	15.9
TkAUNG044890	`PF12872`	OST-HTH	269	336	2.2e-14	53.7
TkAUNG044890	`PF24359`	DUF7515	270	300	0.037	15.0
TkAUNG044890	`PF01936`	NYN	283	315	5.2e-29	102.3
TkAUNG044890	`PF08784`	RPA_C	467	470	0.028	15.9
TkAUNG044890	`PF14418`	OHA	555	614	1e-10	42.0
TkAUNG044890	`PF12872`	OST-HTH	643	702	2.2e-14	53.7
TkAUNG044890	`PF24359`	DUF7515	657	693	0.037	15.0
TkAUNG044890	`PF12872`	OST-HTH	774	795	2.2e-14	53.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card