RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG044740
Reference: TK1151 Chr: ChrUn Coordinates: 12433762-12435105 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

843 bp · TkAUNG044740|TK1151|cDNA

ATGGTTGCTGCCGACTTTGTCGTCGGGATCTTAGGAAACATCGTCTCTATACTCAGTTTCACTTCTCCCATATCACAATTTCGGGAGATTGTGAAGGGAAAAAATGCTGATAACTACAACGGAACACCATATATTGCAACGTTTTTGAGTTGTTCTTTGTGGATTTTGTACGGAGTACTTGACCCAGATGATGGTCTCCTCATTGTGACTGTCAACTCAGCTGGTGTGGGCATGCAAACCCTCTACCTTGCTCTACTTTT...

CDS

Download CDS FASTA

843 bp · TkAUNG044740|TK1151|CDS

ATGGTTGCTGCCGACTTTGTCGTCGGGATCTTAGGAAACATCGTCTCTATACTCAGTTTCACTTCTCCCATATCACAATTTCGGGAGATTGTGAAGGGAAAAAATGCTGATAACTACAACGGAACACCATATATTGCAACGTTTTTGAGTTGTTCTTTGTGGATTTTGTACGGAGTACTTGACCCAGATGATGGTCTCCTCATTGTGACTGTCAACTCAGCTGGTGTGGGCATGCAAACCCTCTACCTTGCTCTACTTTT...

Protein

Download Protein FASTA

280 aa · TkAUNG044740|TK1151|PROTEIN

MVAADFVVGILGNIVSILSFTSPISQFREIVKGKNADNYNGTPYIATFLSCSLWILYGVLDPDDGLLIVTVNSAGVGMQTLYLALLFIYSSPEKRVKYFGFVVLDVVCFGLVVAFTLVAFHGESRRTFTGVICATFTTMMYAAPLAALRTTIKTKSVEYMPILLVFSLFVNGCVWLTFALLVTDVFVLVPNAIGILLGAIQFCVYLMFRNSRPIVNEKQTEIQEFGTEDIDVKSNNMITQKRSLSRLDAFPVIRSPSLLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG044740
TK1151 IDTkAUNG044740
OH-1004 IDLXL04_001279
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG044740
LocationChrUn:12433762-12435105 (+)
DescriptionSimilar to SWEET16: Bidirectional sugar transporter SWEET16
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g28007 Mediates both low-affinity uptake and efflux of sugar across the plasma membrane. No verified direct reference in this release
At3g16690 Mediates both low-affinity uptake and efflux of sugar across the vacuolar membrane.
Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis.2013 · DOI: 10.1104/pp.113.224972
SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves.2014 · DOI: 10.1104/pp.113.232751
At4g15920 Acts as a vacuolar hexose transporter.
Leaf fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis.2013 · DOI: 10.1016/j.cub.2013.03.021
SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves.2014 · DOI: 10.1104/pp.113.232751

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0341300 Mediates both low-affinity uptake and efflux of sugar across the plasma membrane. No verified direct reference in this release
UniProt: A2YZ24 Mediates both low-affinity uptake and efflux of sugar across the plasma membrane. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001279 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0006995 cellular response to nitrogen starvation Biological Process
GO:0007623 circadian rhythm Biological Process
GO:0008643 carbohydrate transport Biological Process
GO:0009409 response to cold Biological Process
GO:0009646 response to absence of light Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009744 response to sucrose Biological Process
GO:0009749 response to glucose Biological Process
GO:0009750 response to fructose Biological Process
GO:0010930 negative regulation of auxin mediated signaling pathway Biological Process
GO:0015755 fructose transmembrane transport Biological Process
KEGG gene cross-reference
ath:AT3G16690
ath:AT4G15920
dosa:Os03g0341300
dosa:Os05g0588500
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.618
Rank 1 · TkAUNG044740 · TK1151
Endoplasmic reticulum0.150
Rank 2 · TkAUNG044740 · TK1151
Lysosome / Vacuole0.134
Rank 3 · TkAUNG044740 · TK1151
Cytoplasm0.101
Rank 4 · TkAUNG044740 · TK1151
Golgi apparatus0.070
Rank 5 · TkAUNG044740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03083MtN3_slv7-93 aa
PF04193PQ-loop9-63 aa
PF03650MPC34-77 aa
PF09882EhaC86-116 aa
PF03083MtN3_slv129-211 aa
PF03650MPC139-214 aa
PF09882EhaC145-180 aa
PF04193PQ-loop150-182 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG044740PF03083MtN3_slv7935.6e-44148.8
TkAUNG044740PF04193PQ-loop9630.810.2
TkAUNG044740PF03650MPC34770.1413.0
TkAUNG044740PF09882EhaC861161.110.0
TkAUNG044740PF03083MtN3_slv1292115.6e-44148.8
TkAUNG044740PF03650MPC1392140.1413.0
TkAUNG044740PF09882EhaC1451801.110.0
TkAUNG044740PF04193PQ-loop1501820.810.2
TkAUNG044740PF04193PQ-loop1962070.810.2
TkAUNG044740PF03083MtN3_slv2372535.6e-44148.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q944M5Arabidopsis thalianasp|Q944M5|SWET4_ARATH Bidirectional sugar transporter SWEET438.800%Swiss-ProtMedium
Q9LUR4Arabidopsis thalianasp|Q9LUR4|SWT16_ARATH Bidirectional sugar transporter SWEET1638.800%Swiss-ProtMedium
Q84WN3Arabidopsis thalianasp|Q84WN3|SWT17_ARATH Bidirectional sugar transporter SWEET1738.900%Swiss-ProtMedium
Q10LN5Oryza sativa subsp. japonicasp|Q10LN5|SWT16_ORYSJ Bidirectional sugar transporter SWEET1646.900%Swiss-ProtMedium
A2YZ24Oryza sativa subsp. indicasp|A2YZ24|SWT7B_ORYSI Bidirectional sugar transporter SWEET7b35.500%Swiss-ProtMedium

JBrowse

View in Genome Browser