RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG044580
Reference: TK1151 Chr: ChrUn Coordinates: 12401381-12403960 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1568 bp · TkAUNG044580|TK1151|cDNA

AAAAACTGAAAAACAAAAAAAAAAATAAACAATTTAATCAAAAACAAATATCAAACGAAACCAAAACACAAACCTTATAATAACCGAAGTATCTTTCTTACTAAAACAGAACCAGAAACAATTTGTTCAGAATTTCATCACCTGATTTGTTCAATGATCACTTCCTTGCTCGGAATTTTGTTATCTGATCACTAATAACATCATCACTACCAGATCTTCGGTCCTCATAATTTCCCCTCATATCGTTGTTCATCGATCGG...

CDS

Download CDS FASTA

963 bp · TkAUNG044580|TK1151|CDS

ATGGCGACAAGGAATAGGACATTTCTCTTTAGGAGGTATAGAGATGCATTGAAGAGCGTTAGGGTTCCGTCGGGCCGTTCTGCGGTTTCCGACGGTGGTGCGATGATCGAAATGGCTGACGCTTCCCTGCTTAAGCAAAATCGTTCTTACGCTCCTCTTAGTACACATGATCCTGGAACTTCCTCTGTGGGGACACCAATGATGGGACTTCCTCCAGCTTGGGTTGACGTATCTGAAGAAATAGCAGCAAACATTCAACG...

Protein

Download Protein FASTA

320 aa · TkAUNG044580|TK1151|PROTEIN

MATRNRTFLFRRYRDALKSVRVPSGRSAVSDGGAMIEMADASLLKQNRSYAPLSTHDPGTSSVGTPMMGLPPAWVDVSEEIAANIQRARSKMSELSKAHAQALMPSFGDGREDQHRIEALTHEVTDLLKKSERSLRRLSAAGRAEDSTVRKNVQRSLATDLQSLSMELRRKQSMYLKRLQQQKEGSDGVDLEMTLNGMHSRSEDDDFDDFGFNEHQMAKLKKSEAFTMERDREIQQVAESVNELAQIMKDLSVLVIDQGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG044580
TK1151 IDTkAUNG044580
OH-1004 IDLXL04_001274
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG044580
LocationChrUn:12401381-12403960 (-)
DescriptionSimilar to SYP43: Syntaxin-43
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g05710 Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.
Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
At5g26980 Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.
YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061
Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
At4g02195 Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.
Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001274 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006886 intracellular protein transport Biological Process
GO:0006896 Golgi to vacuole transport Biological Process
GO:0006906 vesicle fusion Biological Process
GO:0007030 Golgi organization Biological Process
GO:0007034 vacuolar transport Biological Process
GO:0009306 protein secretion Biological Process
GO:0009658 chloroplast organization Biological Process
GO:0009863 salicylic acid mediated signaling pathway Biological Process
GO:0032456 endocytic recycling Biological Process
GO:0042147 retrograde transport, endosome to Golgi Biological Process
GO:0043001 Golgi to plasma membrane protein transport Biological Process
GO:0048278 vesicle docking Biological Process
KEGG gene cross-reference
ath:AT3G05710
ath:AT4G02195
ath:AT5G26980
hsa:8675
mmu:228960
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.631
Rank 1 · TkAUNG044580 · TK1151
Cytoplasm0.254
Rank 2 · TkAUNG044580 · TK1151
Endoplasmic reticulum0.168
Rank 3 · TkAUNG044580 · TK1151
Cell membrane0.116
Rank 4 · TkAUNG044580 · TK1151
Lysosome / Vacuole0.109
Rank 5 · TkAUNG044580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19191HEF_HK73-100 aa
PF14523Syntaxin_278-181 aa
PF00015MCPsignal79-101 aa
PF05739SNARE80-97 aa
PF00745GlutR_dimer80-145 aa
PF15135UPF051597-170 aa
PF09712PHA_synth_III_E99-154 aa
PF03938OmpH101-184 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG044580PF19191HEF_HK731003.7e-0628.1
TkAUNG044580PF14523Syntaxin_2781818.7e-0626.5
TkAUNG044580PF00015MCPsignal791010.1113.1
TkAUNG044580PF05739SNARE80974.7e-2381.5
TkAUNG044580PF00745GlutR_dimer801453.68.7
TkAUNG044580PF15135UPF0515971702.28.3
TkAUNG044580PF09712PHA_synth_III_E991540.02414.6
TkAUNG044580PF03938OmpH1011843.28.7
TkAUNG044580PF06090Ins_P5_2-kin1022920.007416.4
TkAUNG044580PF12845TBD1111300.9210.1
TkAUNG044580PF19191HEF_HK1171653.7e-0628.1
TkAUNG044580PF25118EFL11181670.02915.7
TkAUNG044580PF05739SNARE1201364.7e-2381.5
TkAUNG044580PF07299EF-G-binding_N1431870.0714.3
TkAUNG044580PF09753Use11433140.2311.8
TkAUNG044580PF01519DUF161551550.5111.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SUJ1Arabidopsis thalianasp|Q9SUJ1|SYP43_ARATH Syntaxin-4371.700%Swiss-ProtHigh
O65359Arabidopsis thalianasp|O65359|SYP41_ARATH Tlg2p-like protein a70.900%Swiss-ProtHigh
Q9SWH4Arabidopsis thalianasp|Q9SWH4|SYP42_ARATH Syntaxin-4262.800%Swiss-ProtHigh

JBrowse

View in Genome Browser