RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG044020
Reference: TK1151 Chr: ChrUn Coordinates: 12220301-12223886 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3051 bp · TkAUNG044020|TK1151|cDNA

CAACGACAATAAAGATTCTTCTTTCCATTTATAAATGATAAGAAAAAAGTAGACGGTCGTTGCGTTGGTACCAATTATTGATGAGGGTTGACTTTTCCATTCCAACATTCTTCTCTCTGTTTTGATCAATGACTTCTCAATCATCATCTTCCATGGTTAAATCTTATTTCAGGGCTACTTCACAGCCTTCTTCGATTCGTTATGATGTTTTTTTAAGTTTTCGCGGTGAAGACACTCGTGACAATTTTACAGATCATCTC...

CDS

Download CDS FASTA

2253 bp · TkAUNG044020|TK1151|CDS

ATGACTTCTCAATCATCATCTTCCATGGTTAAATCTTATTTCAGGGCTACTTCACAGCCTTCTTCGATTCGTTATGATGTTTTTTTAAGTTTTCGCGGTGAAGACACTCGTGACAATTTTACAGATCATCTCTATACAGCCTTGAATCAAGCAGGAATCCGCACTTTCCGGGATGATGATGCAATGGATAGAGGGAAACCGCTGACGCCAGAGCTAAAAAAAGCCATCCGCGAGTCTGCAATTTCACTAATCGTCTTCTC...

Protein

Download Protein FASTA

750 aa · TkAUNG044020|TK1151|PROTEIN

MTSQSSSSMVKSYFRATSQPSSIRYDVFLSFRGEDTRDNFTDHLYTALNQAGIRTFRDDDAMDRGKPLTPELKKAIRESAISLIVFSKGYASSTWCLDEVRTIMEKQKTSAVYGNFRYDVLPVFYKVKPSDVRNQRGSFKQAFDKYDDEIKAEKNLKKKTALLLKVSAWRQTLGHAATSTGFVYRDGSESRFIYKIVNAVIKKVDNNALYTEDKLVGMENHVAEIESWLQDPSPYASVLLINGMGGIGKTTIAKIIFNLN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG044020
TK1151 IDTkAUNG044020
OH-1004 IDLXL04_001270
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)95.200
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG044020
LocationChrUn:12220301-12223886 (-)
DescriptionSimilar to RUN1: Disease resistance protein RUN1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g19510 Disease resistance protein that cooperates with RPP2A to confer resistance to Hyaloperonospora parasitica isolate Cala2. No verified direct reference in this release
At5g45060 Disease resistance (R) protein that specifically recognizes the AvrRps4 type III effector avirulence protein from P.syringae. No verified direct reference in this release
At5g44510 TIR-NB-LRR receptor-like protein that contributes to disease resistance induced by the Pseudomonas syringae type III effector AvrB.
Arabidopsis TAO1 is a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB.2008 · DOI: 10.1073/pnas.0802157105
At5g18370 TIR-NB-LRR receptor-like protein involved in plant defense.
Matching NLR Immune Receptors to Autoimmunity in camta3 Mutants Using Antimorphic NLR Alleles.2017 · DOI: 10.1016/j.chom.2017.03.005
At4g12020 Transcription factor. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001270 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007165 signal transduction Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0019677 NAD+ catabolic process Biological Process
GO:0043068 positive regulation of programmed cell death Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0003953 NAD+ nucleosidase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference
ath:AT4G19510
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405
Rank 1 · TkAUNG044020 · TK1151
Cell membrane0.394
Rank 2 · TkAUNG044020 · TK1151
Nucleus0.222
Rank 3 · TkAUNG044020 · TK1151
Endoplasmic reticulum0.077
Rank 4 · TkAUNG044020 · TK1151
Extracellular0.048
Rank 5 · TkAUNG044020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13191AAA_167-84 aa
PF01582TIR25-210 aa
PF13676TIR_227-130 aa
PF28108T7SS_assoc-like46-62 aa
PF13173AAA_1482-103 aa
PF23952LRR_EndoS131-152 aa
PF06309Torsin183-198 aa
PF13191AAA_16214-297 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG044020PF13191AAA_167840.001519.8
TkAUNG044020PF01582TIR252101.6e-42146.1
TkAUNG044020PF13676TIR_2271309.5e-1555.9
TkAUNG044020PF28108T7SS_assoc-like46620.00418.6
TkAUNG044020PF13173AAA_14821030.02715.2
TkAUNG044020PF23952LRR_EndoS1311520.002918.5
TkAUNG044020PF06309Torsin1831980.2312.3
TkAUNG044020PF13191AAA_162142970.001519.8
TkAUNG044020PF00158Sigma54_activat2182650.1812.2
TkAUNG044020PF00931NB-ARC2193937.5e-2175.2
TkAUNG044020PF01637ATPase_22213329e-0523.1
TkAUNG044020PF03215Rad172213280.1612.6
TkAUNG044020PF06309Torsin2222700.2312.3
TkAUNG044020PF24883NPHP3_N2242970.0002322.1
TkAUNG044020PF20720nSTAND32372790.01615.6
TkAUNG044020PF13173AAA_142373360.02715.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4JT80Arabidopsis thalianasp|F4JT80|RPP2B_ARATH Disease resistance protein RPP2B32.900%Swiss-ProtMedium
Q9FHF0Arabidopsis thalianasp|Q9FHF0|RPS4B_ARATH Disease resistance protein RPS4B28.300%Swiss-ProtLow
Q9FI14Arabidopsis thalianasp|Q9FI14|TAO1_ARATH Disease resistance protein TAO126.700%Swiss-ProtLow
F4JWM0Arabidopsis thalianasp|F4JWM0|DSC2_ARATH Disease resistance-like protein DSC227.600%Swiss-ProtLow
Q9SZ67Arabidopsis thalianasp|Q9SZ67|WRK19_ARATH Probable WRKY transcription factor 1927.800%Swiss-ProtLow

JBrowse

View in Genome Browser