TkAUNG039960 | RubberDandelionOmics

Gene overview

TkAUNG039960

Reference: TK1151 Chr: ChrUn Coordinates: 11177786-11182558 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2774 bp · TkAUNG039960|TK1151|cDNA

TCTCTCTGGCTGATTGTGAGAACTTTTGTAGCTCATATCCCCTTCACCCCCATCTCTCAAATTAATCGATTTCACTGTTTTTTTCTCTCTAAAAATCCAAAATTAGGGTTTTTGTTCTCTTTTGCTACAATTGTTATAAGCGGCCAATCGTTAATCTCTAGTTTCTGTAATCTCTTCTACTCATCTAGGGTTTGCAGATCTAAACCAGTTATATTCAACATGTTTTGGCATCTTACAGCTATCTCTGCTTCTTCTCCGAT...

CDS

Download CDS FASTA

1110 bp · TkAUNG039960|TK1151|CDS

TCTCTCTGGCTGATTGTGAGAACTTTTGTAGCTCATATCCCCTTCACCCCCATCTCTCAAATTAATCGATTTCACTGTTTTTTTCTCTCTAAAAATCCAAAATTAGGGTTTTTGTTCTCTTTTGCTACAATTGTTATAAGCGGCCAATCGTTAATCTCTAGTTTCTGTAATCTCTTCTACTCATCTAGGGTTTGCAGATCTAAACCAGTTATATTCAACATGTTTTGGCATCTTACAGCTATCTCTGCTTCTTCTCCGAT...

Protein

Download Protein FASTA

369 aa · TkAUNG039960|TK1151|PROTEIN

SLWLIVRTFVAHIPFTPISQINRFHCFFLSKNPKLGFLFSFATIVISGQSLISSFCNLFYSSRVCRSKPVIFNMFWHLTAISASSPIETILDKESFTLEEILDEEDVIQECKALNSRLINFLRDRSQLEQLLRYITEEPQADADSKRIFKFPFIACEIFTCEIDVIFKTLVEEEELMDLLFSFLEPTRSHSALLAGYFSKVVICLMLRKTVPLMNYVQVHQNVFQQLVDLIGITSIMEVLVRLVGSDDHMYPDSAEVMQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG039960`
TK1151 ID	TkAUNG039960
OH-1004 ID	LXL04_033055
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.100
Protein coverage (%)	TK1151 75.881 / OH-1004 35.088 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG039960`
Location	ChrUn:11177786-11182558 (-)
Description	Similar to PPP6R3: Serine/threonine-protein phosphatase 6 regulatory subunit 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033055` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009966 regulation of signal transduction Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0036464 cytoplasmic ribonucleoprotein granule Cellular Component GO:0019888 protein phosphatase regulator activity Molecular Function GO:0019903 protein phosphatase binding Molecular Function
KEGG gene cross-reference	gga:423116 hsa:55291 mmu:52036 xla:431944 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.389

Rank 1 · TkAUNG039960 · TK1151

Nucleus0.280

Rank 2 · TkAUNG039960 · TK1151

Golgi apparatus0.175

Rank 3 · TkAUNG039960 · TK1151

Endoplasmic reticulum0.166

Rank 4 · TkAUNG039960 · TK1151

Cell membrane0.136

Rank 5 · TkAUNG039960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09302XLF100-141 aa

PF04499SAPS203-342 aa

PF00514Arm219-232 aa

PF22880DUF7019224-318 aa

PF00514Arm235-248 aa

PF00514Arm259-294 aa

PF09302XLF266-294 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG039960	`PF09302`	XLF	100	141	0.21	12.6
TkAUNG039960	`PF04499`	SAPS	203	342	1.6e-24	87.4
TkAUNG039960	`PF00514`	Arm	219	232	0.026	15.3
TkAUNG039960	`PF22880`	DUF7019	224	318	0.17	12.3
TkAUNG039960	`PF00514`	Arm	235	248	0.026	15.3
TkAUNG039960	`PF00514`	Arm	259	294	0.026	15.3
TkAUNG039960	`PF09302`	XLF	266	294	0.21	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card