TkAUNG037550 | RubberDandelionOmics

Gene overview

TkAUNG037550

Reference: TK1151 Chr: ChrUn Coordinates: 10248912-10250670 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1302 bp · TkAUNG037550|TK1151|cDNA

ATGGTGCGCGATATTATAAACGATCCGTACTACCAGAACAGACGAGAAAGCACTAGTGAATCTCTACTCTTGGATCTATTGGATGCCGAAAATGATCACCTGGTTGACCAAGGTTACTCCGAGCAGCAGAGATTTATCGACATCAGGCCGATTGCTTATCACTATTGTCTAAAGCACGCAGATATGATCGTTGCTTATAATGCTCTGACTTATTACGATCGCTTCTTGGCAAGAAATTTTGATATACCGATGATGCAGGG...

CDS

Download CDS FASTA

1302 bp · TkAUNG037550|TK1151|CDS

ATGGTGCGCGATATTATAAACGATCCGTACTACCAGAACAGACGAGAAAGCACTAGTGAATCTCTACTCTTGGATCTATTGGATGCCGAAAATGATCACCTGGTTGACCAAGGTTACTCCGAGCAGCAGAGATTTATCGACATCAGGCCGATTGCTTATCACTATTGTCTAAAGCACGCAGATATGATCGTTGCTTATAATGCTCTGACTTATTACGATCGCTTCTTGGCAAGAAATTTTGATATACCGATGATGCAGGG...

Protein

Download Protein FASTA

433 aa · TkAUNG037550|TK1151|PROTEIN

MVRDIINDPYYQNRRESTSESLLLDLLDAENDHLVDQGYSEQQRFIDIRPIAYHYCLKHADMIVAYNALTYYDRFLARNFDIPMMQGLGFERNLELFVFACIGMVYREMFQEYFDFHYFVNSHHVADERDVRKMELLIWNGLEGSEVTPPNAIDPFIIDPLLSLLEMEDQLPDLVHYVDQILFAINKDIKFTKFRPSILAASAILVTCFRLHPVLYPTLAKKIFKSGYVQQVLKDPDVRKFILLTEVRECFDELKDHVIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG037550`
TK1151 ID	TkAUNG037550
OH-1004 ID	LXL04_037577
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.100
Protein coverage (%)	TK1151 97.921 / OH-1004 86.270 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG037550`
Location	ChrUn:10248912-10250670 (-)
Description	Similar to CYCD6-1: Putative cyclin-D6-1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037577` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000082 G1/S transition of mitotic cell cycle Biological Process GO:0051301 cell division Biological Process GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016538 cyclin-dependent protein serine/threonine kinase regulator activity Molecular Function
KEGG gene cross-reference	ath:AT4G03270 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.771

Rank 1 · TkAUNG037550 · TK1151

Cytoplasm0.399

Rank 2 · TkAUNG037550 · TK1151

Mitochondrion0.026

Rank 3 · TkAUNG037550 · TK1151

Cell membrane0.023

Rank 4 · TkAUNG037550 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkAUNG037550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00134Cyclin_N64-143 aa

PF02984Cyclin_C181-213 aa

PF06514PsbU205-256 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG037550	`PF00134`	Cyclin_N	64	143	0.17	12.3
TkAUNG037550	`PF02984`	Cyclin_C	181	213	0.012	16.3
TkAUNG037550	`PF06514`	PsbU	205	256	0.04	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card