TkAUNG034700 | RubberDandelionOmics

Gene overview

TkAUNG034700

Reference: TK1151 Chr: ChrUn Coordinates: 9413123-9420452 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1575 bp · TkAUNG034700|TK1151|cDNA

ATGGAGTCATCAGATTCGATATTGAATGTCAATTTTAGTGAGCAACGATGGGTGGACCAAATCGGCAAGCATTTCGATGACGAAGTTGGCAACATTAGCCACATTACCGTTTCTGTTTTTAGTGTCCCGATATCCACAACCCATTTCAAGCCTGAAGCTTACGTACCTCTGGCTATAGCACTAGGACCTTACCACCATTTCGATACTCATCTCTACCAAATGGAGAGGTACAAAGTGGCAGCTGTTAAAGCCCTTTTAAA...

CDS

Download CDS FASTA

1575 bp · TkAUNG034700|TK1151|CDS

ATGGAGTCATCAGATTCGATATTGAATGTCAATTTTAGTGAGCAACGATGGGTGGACCAAATCGGCAAGCATTTCGATGACGAAGTTGGCAACATTAGCCACATTACCGTTTCTGTTTTTAGTGTCCCGATATCCACAACCCATTTCAAGCCTGAAGCTTACGTACCTCTGGCTATAGCACTAGGACCTTACCACCATTTCGATACTCATCTCTACCAAATGGAGAGGTACAAAGTGGCAGCTGTTAAAGCCCTTTTAAA...

Protein

Download Protein FASTA

524 aa · TkAUNG034700|TK1151|PROTEIN

MESSDSILNVNFSEQRWVDQIGKHFDDEVGNISHITVSVFSVPISTTHFKPEAYVPLAIALGPYHHFDTHLYQMERYKVAAVKALLNHDQVLLLSFESVVINRLKEKELMIRSCYHKYINLDRDTLAWIIAIDGLFLLDILSHYGDVAPLIPKKLINGGVLSRDIMVLDNQIPLRLLFEIQKGIRLSSTDQFENGERELFSMMREFCKVHSPLKLENYSNENHEITSYLHLLDLMYHLIVNNKSTTEPPHVVVLPHNYND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG034700`
TK1151 ID	TkAUNG034700
OH-1004 ID	LXL04_002760
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	71.800
Protein coverage (%)	TK1151 97.519 / OH-1004 97.692 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG034700

Location ChrUn:9413123-9420452 (-)

Description Similar to At3g02645: Putative UPF0481 protein At3g02645

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02645`	Putative UPF0481 protein At3g02645.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002760 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G02645

ath:AT3G47200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.704

Rank 1 · TkAUNG034700 · TK1151

Cytoplasm0.153

Rank 2 · TkAUNG034700 · TK1151

Nucleus0.124

Rank 3 · TkAUNG034700 · TK1151

Endoplasmic reticulum0.084

Rank 4 · TkAUNG034700 · TK1151

Lysosome / Vacuole0.037

Rank 5 · TkAUNG034700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03140DUF24739-504 aa

PF23906DUF7248483-515 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG034700	`PF03140`	DUF247	39	504	2.8e-76	258.2
TkAUNG034700	`PF23906`	DUF7248	483	515	0.54	11.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C897`	Arabidopsis thaliana	sp\|P0C897\|Y3264_ARATH Putative UPF0481 protein At3g02645	31.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card