TkAUNG029170 | RubberDandelionOmics

Gene overview

TkAUNG029170

Reference: TK1151 Chr: ChrUn Coordinates: 7869707-7875027 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2902 bp · TkAUNG029170|TK1151|cDNA

ATTGAACCACCGTTAAACCTCTGACTGTCTTCCATTTTTCCTTACTACCGTCGACCAGGCCGCCATTATCGTTAAGTCTTAGAAGCTCTTTGCAAGTACCAGATATTATAGATGGAGAACAAGGATAAGATCAAAATCGCATTTACAATCTCATGTCTTGCGGTGGTTTCAATCTTACTAGCGAACAAATTTCGGAAACAACGAAAACGAAAACAGAACATAGGCTCGTGTTACTTGAAATCGGAAGCAAAACCTCAACA...

CDS

Download CDS FASTA

2613 bp · TkAUNG029170|TK1151|CDS

ATGGAGAACAAGGATAAGATCAAAATCGCATTTACAATCTCATGTCTTGCGGTGGTTTCAATCTTACTAGCGAACAAATTTCGGAAACAACGAAAACGAAAACAGAACATAGGCTCGTGTTACTTGAAATCGGAAGCAAAACCTCAACACAATTTTAAGCGTGTATTGGCCAACAATTCGTACTCTGCGTTCAAGCACCTCAAGCTCGACGATGACAGCTCTTCAGATTTGCATCCATTTGAGTCGGAGATCAAAGCACT...

Protein

Download Protein FASTA

870 aa · TkAUNG029170|TK1151|PROTEIN

MENKDKIKIAFTISCLAVVSILLANKFRKQRKRKQNIGSCYLKSEAKPQHNFKRVLANNSYSAFKHLKLDDDSSSDLHPFESEIKALLENPELEFEFCDGTMSMDMSDTYVWIDDESKLKELAQVLSKERVFAVDTEQHSLRSFLGFTALIQISTREEDYLVDTIAVHDYMGILFPVFANPNICKVFHGADNDVIWLQRDFHIYVVNLFDTAKACDVLSKPQRSLAYLLETYCGVTTNKFYQREDWRQRPLPIDMVEYAR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG029170`
TK1151 ID	TkAUNG029170
OH-1004 ID	LXL04_038192
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	95.000
Protein coverage (%)	TK1151 98.736 / OH-1004 99.887 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG029170

Location ChrUn:7869707-7875027 (-)

Description Similar to RRP6L3: Protein RRP6-like 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32415`	Protein RRP6-like 3.	No verified direct reference in this release
`At5g35910`	Acts as an important epigenetic regulator through multiple silencing mechanisms.	Degradation of a polyadenylated rRNA maturation by-product involves one of the three RRP6-like proteins in Arabidopsis thaliana.2008 · DOI: 10.1128/mcb.02064-07 Arabidopsis RRP6L1 and RRP6L2 function in FLOWERING LOCUS C silencing via regulation of antisense RNA synthesis.2014 · DOI: 10.1371/journal.pgen.1004612
`At1g54440`	Acts as an important epigenetic regulator through multiple silencing mechanisms.	Degradation of a polyadenylated rRNA maturation by-product involves one of the three RRP6-like proteins in Arabidopsis thaliana.2008 · DOI: 10.1128/mcb.02064-07 An Rrp6-like protein positively regulates noncoding RNA levels and DNA methylation in Arabidopsis.2014 · DOI: 10.1016/j.molcel.2014.03.019 Arabidopsis RRP6L1 and RRP6L2 function in FLOWERING LOCUS C silencing via regulation of antisense RNA synthesis.2014 · DOI: 10.1371/journal.pgen.1004612

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038192 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0000460 maturation of 5.8S rRNA Biological Process

GO:0000467 exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process

GO:0006281 DNA repair Biological Process

GO:0006346 DNA methylation-dependent constitutive heterochromatin formation Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006396 RNA processing Biological Process

GO:0006401 RNA catabolic process Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process

GO:0033621 nuclear mRNA surveillance of meiosis-specific transcripts Biological Process

KEGG gene cross-reference

ath:AT1G54440

ath:AT2G32415

ath:AT5G35910

rno:313707

spo:2543630

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.508

Rank 1 · TkAUNG029170 · TK1151

Nucleus0.455

Rank 2 · TkAUNG029170 · TK1151

Mitochondrion0.120

Rank 3 · TkAUNG029170 · TK1151

Cell membrane0.055

Rank 4 · TkAUNG029170 · TK1151

Golgi apparatus0.053

Rank 5 · TkAUNG029170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01612DNA_pol_A_exo149-101 aa

PF01612DNA_pol_A_exo1110-277 aa

PF26121HTH_CDT1337-355 aa

PF00570HRDC346-390 aa

PF10913DUF2706366-414 aa

PF22113Mtrc-MtrF_II-IV_dom592-652 aa

PF26121HTH_CDT1680-743 aa

PF17221COMMD1_N706-738 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG029170	`PF01612`	DNA_pol_A_exo1	49	101	1.3e-52	178.9
TkAUNG029170	`PF01612`	DNA_pol_A_exo1	110	277	1.3e-52	178.9
TkAUNG029170	`PF26121`	HTH_CDT1	337	355	0.087	13.4
TkAUNG029170	`PF00570`	HRDC	346	390	1e-08	35.7
TkAUNG029170	`PF10913`	DUF2706	366	414	0.11	13.1
TkAUNG029170	`PF22113`	Mtrc-MtrF_II-IV_dom	592	652	0.048	13.9
TkAUNG029170	`PF26121`	HTH_CDT1	680	743	0.087	13.4
TkAUNG029170	`PF17221`	COMMD1_N	706	738	0.18	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A9LLI8`	Arabidopsis thaliana	sp\|A9LLI8\|RP6L3_ARATH Protein RRP6-like 3	60.600%	Swiss-Prot	High
`A9LLI7`	Arabidopsis thaliana	sp\|A9LLI7\|RP6L2_ARATH Protein RRP6-like 2	38.300%	Swiss-Prot	Low
`Q0WVE8`	Arabidopsis thaliana	sp\|Q0WVE8\|RP6L1_ARATH Protein RRP6-like 1	38.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card