TkAUNG028080 | RubberDandelionOmics

Gene overview

TkAUNG028080

Reference: TK1151 Chr: ChrUn Coordinates: 7557909-7559570 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · TkAUNG028080|TK1151|cDNA

CGCAATTCCGCAACGGCTTGGACTCTAGAGTCGTAAAGTGGACTTGTGAACGACCAAGAACCCTAAATCATCCCATGAAGGATCCCAAAATCACAGCGATTTTCGCTACAATTACTCGTAATTTTCCCATGTAAAGTACCTTCAGTTGACGCCATTACTCGACACTGCTCCTATAACCTTCATCCCTCCTGCTCACAAATCACAATTTCACTGCGCCTTTCTTTCCTTTCGCTTTTTTGATTAGATGGGGAATGTAAATC...

CDS

Download CDS FASTA

732 bp · TkAUNG028080|TK1151|CDS

ATGGGGAATGTAAATCAGACACCCCAACAAAATCCACCAATCCTTCAACAAGCCGAAGAAGAAGAATCAGCATCATCAACATTCACCTGCGAGATTTGCATCGAACCCGTAACACTCCCCAACAAGAGATTCAAAAACAGCAACAGATGCGTCCACCCCTTTTGCACCGACTGTATGATCAAATACATCCAAGTGAAGCTCGAGGACAACGTATCCGACATCAAATGTCCGGCACTGACCTGCGATCACTCGCTCGAACC...

Protein

Download Protein FASTA

243 aa · TkAUNG028080|TK1151|PROTEIN

MGNVNQTPQQNPPILQQAEEEESASSTFTCEICIEPVTLPNKRFKNSNRCVHPFCTDCMIKYIQVKLEDNVSDIKCPALTCDHSLEPLSCRPKIAHQLFDKWCDVLCESAVLGLDRAYCPNRDCSALVINECGGEGNLKRCVCPNCKKPFCFGVRFHGMLGIGARESGEMRDRNDIAFGVLSERNQWMRCPMCRHCVELVKGCAIVKCRCGIDFVTSVEKRWITIGAIVEDHRHFACGFFTCA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG028080`
TK1151 ID	TkAUNG028080
OH-1004 ID	LXL04_038221
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.400
Protein coverage (%)	TK1151 90.947 / OH-1004 83.396 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG028080`
Location	ChrUn:7557909-7559570 (-)
Description	Similar to rnf217: Probable E3 ubiquitin-protein ligase RNF217
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038221` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0002221 pattern recognition receptor signaling pathway Biological Process GO:0002376 immune system process Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009740 gibberellic acid mediated signaling pathway Biological Process GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process GO:0010286 heat acclimation Biological Process GO:0010431 seed maturation Biological Process GO:0010476 gibberellin mediated signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0050829 defense response to Gram-negative bacterium Biological Process
KEGG gene cross-reference	ath:AT2G26130 dme:Dmel_CG11321 hsa:9781 xla:734643 xtr:100124307 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.657

Rank 1 · TkAUNG028080 · TK1151

Cytoplasm0.403

Rank 2 · TkAUNG028080 · TK1151

Endoplasmic reticulum0.059

Rank 3 · TkAUNG028080 · TK1151

Cell membrane0.058

Rank 4 · TkAUNG028080 · TK1151

Mitochondrion0.024

Rank 5 · TkAUNG028080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15292Treslin_M23-49 aa

PF25164CoiA_N23-39 aa

PF01485IBR29-59 aa

PF00097zf-C3HC430-77 aa

PF01485IBR70-86 aa

PF00097zf-C3HC477-84 aa

PF15292Treslin_M79-95 aa

PF01485IBR115-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG028080	`PF15292`	Treslin_M	23	49	0.16	12.7
TkAUNG028080	`PF25164`	CoiA_N	23	39	4.6	7.5
TkAUNG028080	`PF01485`	IBR	29	59	0.0045	17.7
TkAUNG028080	`PF00097`	zf-C3HC4	30	77	0.0018	18.8
TkAUNG028080	`PF01485`	IBR	70	86	0.0045	17.7
TkAUNG028080	`PF00097`	zf-C3HC4	77	84	0.0018	18.8
TkAUNG028080	`PF15292`	Treslin_M	79	95	0.16	12.7
TkAUNG028080	`PF01485`	IBR	115	152	0.0045	17.7
TkAUNG028080	`PF00097`	zf-C3HC4	124	146	0.0018	18.8
TkAUNG028080	`PF25164`	CoiA_N	140	149	4.6	7.5
TkAUNG028080	`PF01485`	IBR	181	214	0.0045	17.7
TkAUNG028080	`PF25164`	CoiA_N	189	202	4.6	7.5
TkAUNG028080	`PF00097`	zf-C3HC4	192	201	0.0018	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card