TkAUNG026930 | RubberDandelionOmics

Gene overview

TkAUNG026930

Reference: TK1151 Chr: ChrUn Coordinates: 7204913-7206142 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

905 bp · TkAUNG026930|TK1151|cDNA

ATATGGTTTACATGGGGAACATCAACCTCAATAAAATGAAGCATTGAATGATTCCTCTTCCCGTTGTCACTACGCAATTTGATACACCGAAAGCTGCAACTTCGTGGTCAATAATGGCGGACAAGAAAGAAAAGACGGCCGTTCAGGCTACAGAAAGCTCTGAAATGGGAAGATCTCGAGAAGATGAAGTTGCAGGAGATGGCAACTCTGGTATCCGGACGGCGGAGACTCTACTGAGGCTGTTTCCGGTGGGGTTGTGT...

CDS

Download CDS FASTA

687 bp · TkAUNG026930|TK1151|CDS

ATGATTCCTCTTCCCGTTGTCACTACGCAATTTGATACACCGAAAGCTGCAACTTCGTGGTCAATAATGGCGGACAAGAAAGAAAAGACGGCCGTTCAGGCTACAGAAAGCTCTGAAATGGGAAGATCTCGAGAAGATGAAGTTGCAGGAGATGGCAACTCTGGTATCCGGACGGCGGAGACTCTACTGAGGCTGTTTCCGGTGGGGTTGTGTGTGGCTGCGCTGGTGGTTATGCTTAAGGACTCTGAAACTAATGAATA...

Protein

Download Protein FASTA

228 aa · TkAUNG026930|TK1151|PROTEIN

MIPLPVVTTQFDTPKAATSWSIMADKKEKTAVQATESSEMGRSREDEVAGDGNSGIRTAETLLRLFPVGLCVAALVVMLKDSETNEYGSLSYSNITAFRFLVHANGICAGYSLLSAAFTAIPRPITMSRAWTFFLLDQVLTYLILAAGAVATEVAFLSYKGDLAVTWSEVCGTYGHFCKSATASIIITFTVVICYVLLSLISSYRLFSKYDAPVGYHNKGIEIVDFGN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG026930`
TK1151 ID	TkAUNG026930
OH-1004 ID	LXL04_037896
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 90.351 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG026930

Location ChrUn:7204913-7206142 (-)

Description Similar to VIT_01s0010g01870: CASP-like protein 2A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17200`	CASP-like protein 2A1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037896 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0090376 seed trichome differentiation Biological Process

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ghi:107932682

gmx:100790042

pop:7454447

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.848

Rank 1 · TkAUNG026930 · TK1151

Endoplasmic reticulum0.091

Rank 2 · TkAUNG026930 · TK1151

Cytoplasm0.069

Rank 3 · TkAUNG026930 · TK1151

Nucleus0.042

Rank 4 · TkAUNG026930 · TK1151

Lysosome / Vacuole0.041

Rank 5 · TkAUNG026930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04535CASP_dom16-32 aa

PF04535CASP_dom54-194 aa

PF14004DUF4227131-144 aa

PF14004DUF4227187-215 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG026930	`PF04535`	CASP_dom	16	32	1.4e-38	132.7
TkAUNG026930	`PF04535`	CASP_dom	54	194	1.4e-38	132.7
TkAUNG026930	`PF14004`	DUF4227	131	144	0.25	12.0
TkAUNG026930	`PF14004`	DUF4227	187	215	0.25	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZQ3`	Arabidopsis thaliana	sp\|Q8VZQ3\|CSPL3_ARATH CASP-like protein 2A1	68.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card