TkAUNG026470 | RubberDandelionOmics

Gene overview

TkAUNG026470

Reference: TK1151 Chr: ChrUn Coordinates: 7097976-7099206 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

908 bp · TkAUNG026470|TK1151|cDNA

ATATGGTTTACATGGGGAACATCAACCTCAATAAAATGAAGCATTGAATGATTCCTCTTCCCGTTGTCACTACGCAATTTGATACACCGAAAGCTGCAACTTCGTGGTCAATAATGGCGGTCGACAAGAAAGAAAAGACGGCCGTTCAGGCTACAGAAAGCTCTGAAATGGGAAGATCTCGAGAAGATGAAGTTGCAGGAGATGGCAACTCTGGTATCCGGACGGCGGAGACTCTACTGAGGCTGTTTCCGGTGGGGTTG...

CDS

Download CDS FASTA

690 bp · TkAUNG026470|TK1151|CDS

ATGATTCCTCTTCCCGTTGTCACTACGCAATTTGATACACCGAAAGCTGCAACTTCGTGGTCAATAATGGCGGTCGACAAGAAAGAAAAGACGGCCGTTCAGGCTACAGAAAGCTCTGAAATGGGAAGATCTCGAGAAGATGAAGTTGCAGGAGATGGCAACTCTGGTATCCGGACGGCGGAGACTCTACTGAGGCTGTTTCCGGTGGGGTTGTGTGTGGCGGCGCTGGTGGTTATGCTTAAGGATTCTGAAACTAATGA...

Protein

Download Protein FASTA

229 aa · TkAUNG026470|TK1151|PROTEIN

MIPLPVVTTQFDTPKAATSWSIMAVDKKEKTAVQATESSEMGRSREDEVAGDGNSGIRTAETLLRLFPVGLCVAALVVMLKDSETNEYGSLSYSNITAFRFLVHANGICAGYSLLSAAFTAIPRPITMSRAWTFFLLDQVLTYLTLAAGAVATEVAFLSYKGDLAVTWSEVCGTYGHFCKSATASIIITFTVVICYVLLSLISSYRLFSKYDAPVGYHNKGIEIVDFGN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG026470`
TK1151 ID	TkAUNG026470
OH-1004 ID	LXL04_037896
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 89.083 / OH-1004 99.029 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG026470

Location ChrUn:7097976-7099206 (-)

Description Similar to VIT_01s0010g01870: CASP-like protein 2A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17200`	CASP-like protein 2A1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037896 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0090376 seed trichome differentiation Biological Process

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ghi:107932682

gmx:100790042

pop:7454447

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.855

Rank 1 · TkAUNG026470 · TK1151

Endoplasmic reticulum0.090

Rank 2 · TkAUNG026470 · TK1151

Cytoplasm0.068

Rank 3 · TkAUNG026470 · TK1151

Nucleus0.041

Rank 4 · TkAUNG026470 · TK1151

Lysosome / Vacuole0.037

Rank 5 · TkAUNG026470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06742DUF121410-56 aa

PF04535CASP_dom16-36 aa

PF04535CASP_dom55-195 aa

PF14004DUF4227188-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG026470	`PF06742`	DUF1214	10	56	0.17	13.1
TkAUNG026470	`PF04535`	CASP_dom	16	36	1.2e-38	132.9
TkAUNG026470	`PF04535`	CASP_dom	55	195	1.2e-38	132.9
TkAUNG026470	`PF14004`	DUF4227	188	216	0.14	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZQ3`	Arabidopsis thaliana	sp\|Q8VZQ3\|CSPL3_ARATH CASP-like protein 2A1	68.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card