TkAUNG024160 | RubberDandelionOmics

Gene overview

TkAUNG024160

Reference: TK1151 Chr: ChrUn Coordinates: 6471853-6475258 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2371 bp · TkAUNG024160|TK1151|cDNA

GAAACAAATGCGCCCTAATCCAAACAGTTTAATTTGATTTAGTTTTACACTTAAACTGGAATTATTGATTTCAGAAATAAATAAATCCAGTCGTTCAGTTTTTACTTTTTACAACCATTCTAGTTTTCAGCCGTTATTTTCGATTTTGGAATCAGCGACTTTGCTCCAAGTCAAGCACATGGCTTTTCCTCGTTTTTGCAGACGACGAACCCCCTCAATGTGGAAGACTCTGATTGTGAACTAGTCTACGTTGACTTGCT...

CDS

Download CDS FASTA

1308 bp · TkAUNG024160|TK1151|CDS

ATGCGTAACTTCATTCGATTTACTCACTTCACTCTGATAATGAGGATCACCAGCTGGTCATGTTTGATTCTCAATTGGGTAAATGTAGGCGGATTCACTTTGATTGTAACCTTATGGGGTTTATCAAGTCTCGAAGGCGTTTGTTCACATGGAGTTCACCCTCTCGCGAGAATTGCCATAGAGAACACAGTATTGGACCTTAATAATTCTGCTTCCAGTGTTAAAGTCTCCCCTTCAGTTCTCGGAACAGGGGGGCAAAG...

Protein

Download Protein FASTA

435 aa · TkAUNG024160|TK1151|PROTEIN

MRNFIRFTHFTLIMRITSWSCLILNWVNVGGFTLIVTLWGLSSLEGVCSHGVHPLARIAIENTVLDLNNSASSVKVSPSVLGTGGQSFDWVNVNISNPNPSDNDWIGVFSPSNFSSSTCAPENSKVLAPLLCTAPIKYKYVKDGNPNYKNTGKALLKFRLINQRSDFSLALFTGGLSKPKLVTVSNTIAFSNPNVPNYPRLAQGKLWNQMSVTWTSGYGTREARPFVEWGRKGENQRRSSATTITFNRNHMCGAPAKTVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG024160`
TK1151 ID	TkAUNG024160
OH-1004 ID	LXL04_025115
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.400
Protein coverage (%)	TK1151 96.092 / OH-1004 34.370 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG024160

Location ChrUn:6471853-6475258 (-)

Description Similar to PAP1: Probable inactive purple acid phosphatase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50400`	Probable inactive purple acid phosphatase 27.	No verified direct reference in this release
`At1g13750`	Probable inactive purple acid phosphatase 1.	No verified direct reference in this release
`At4g24890`	Probable inactive purple acid phosphatase 24.	No verified direct reference in this release
`At2g03450`	Probable inactive purple acid phosphatase 9.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025115 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G13750

ath:AT4G24890

ath:AT5G50400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.364

Rank 1 · TkAUNG024160 · TK1151

Lysosome / Vacuole0.213

Rank 2 · TkAUNG024160 · TK1151

Cell membrane0.157

Rank 3 · TkAUNG024160 · TK1151

Cytoplasm0.127

Rank 4 · TkAUNG024160 · TK1151

Endoplasmic reticulum0.094

Rank 5 · TkAUNG024160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00149Metallophos25-110 aa

PF17808fn3_PAP74-192 aa

PF16656Pur_ac_phosph_N198-303 aa

PF00149Metallophos315-408 aa

PF17808fn3_PAP336-358 aa

PF16656Pur_ac_phosph_N377-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG024160	`PF00149`	Metallophos	25	110	1.4e-08	36.1
TkAUNG024160	`PF17808`	fn3_PAP	74	192	1e-40	139.2
TkAUNG024160	`PF16656`	Pur_ac_phosph_N	198	303	1.3e-13	52.0
TkAUNG024160	`PF00149`	Metallophos	315	408	1.4e-08	36.1
TkAUNG024160	`PF17808`	fn3_PAP	336	358	1e-40	139.2
TkAUNG024160	`PF16656`	Pur_ac_phosph_N	377	411	1.3e-13	52.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5MAU8`	Arabidopsis thaliana	sp\|Q5MAU8\|PPA27_ARATH Probable inactive purple acid phosphatase 27	62.800%	Swiss-Prot	High
`Q9LMX4`	Arabidopsis thaliana	sp\|Q9LMX4\|PPA1_ARATH Probable inactive purple acid phosphatase 1	61.900%	Swiss-Prot	High
`Q8H1R2`	Arabidopsis thaliana	sp\|Q8H1R2\|PPA24_ARATH Probable inactive purple acid phosphatase 24	59.300%	Swiss-Prot	High
`Q9ZQ81`	Arabidopsis thaliana	sp\|Q9ZQ81\|PPA9_ARATH Probable inactive purple acid phosphatase 9	31.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card