TkAUNG024020 | RubberDandelionOmics

Gene overview

TkAUNG024020

Reference: TK1151 Chr: ChrUn Coordinates: 6448002-6450555 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

864 bp · TkAUNG024020|TK1151|cDNA

TTTTCATATGCAAAATATCTCTCTTGATATATTGATAATCATCAATTAATACAAGAACTTTACTACATCGATCATTGTTTCCATTCGTGTGATCATGAACTTTGAAGTGCAAGCTGAGAGGGTGGCAAACATGGATCCGCCTGTTCAAACACCTCCCTCCGATCAACATCTTTGCTACGTTCGTTGCAACTTTTGCAATACCCTTCTTGCGGTAGGAATACCATGCAAGAGGCTACTGGATACAGTCACAGTGAAATGCG...

CDS

Download CDS FASTA

420 bp · TkAUNG024020|TK1151|CDS

ATGCAAGAGGCTACTGGATACAGTCACAGTGAAATGCGGACATTGCAGCAGCAATTGTCATTTCTCACGATAAGACCTTCTCCTCCAGATCATCTTCTTCAACCTCCTCCCCTTCCTTCTTTTCCGTCTGCTTTTTCTGGTGATCTCAAAAGGGGACAATCTTCATCTTCTTCATCATCCACATCAAACGAGCCCACATCCCCAAAAGCTCCATTTGTCGTAAAACCACCTGAGAAGAAACACAGGCTCCCATCTGCTTA...

Protein

Download Protein FASTA

139 aa · TkAUNG024020|TK1151|PROTEIN

MQEATGYSHSEMRTLQQQLSFLTIRPSPPDHLLQPPPLPSFPSAFSGDLKRGQSSSSSSSTSNEPTSPKAPFVVKPPEKKHRLPSAYNRFMKEEIQRIKASNPQIPHREAFSTAAKNWAGHIPNGSISGSINTGLIFQD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG024020`
TK1151 ID	TkAUNG024020
OH-1004 ID	LXL04_025104
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 82.734 / OH-1004 63.889 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG024020

Location ChrUn:6448002-6450555 (-)

Description Similar to DL: Protein DROOPING LEAF

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45190`	Involved in the abaxial cell fate determination during embryogenesis and organogenesis.	No verified direct reference in this release
`At1g69180`	Transcription factor required for the initiation of nectary development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0215200`	Regulates carpel specification in flower development.	No verified direct reference in this release
`Os07g0160100`	May play a role in floral meristem development and maintenance of stamens, rather than in determining polarity in floral organs.	Ectopic expression of OsYAB1 causes extra stamens and carpels in rice.2004 · DOI: 10.1007/s11103-004-2648-y The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism.2007 · DOI: 10.1104/pp.107.096586
`Os03g0650000`	Protein YABBY 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025104 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003002 regionalization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0010022 meristem determinacy Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0010158 abaxial cell fate specification Biological Process

GO:0010254 nectary development Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0045165 cell fate commitment Biological Process

GO:0048366 leaf development Biological Process

GO:0048440 carpel development Biological Process

KEGG gene cross-reference

ath:AT1G08465

ath:AT1G69180

ath:AT2G26580

dosa:Os03g0215200

dosa:Os03g0650000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.773

Rank 1 · TkAUNG024020 · TK1151

Cytoplasm0.311

Rank 2 · TkAUNG024020 · TK1151

Cell membrane0.049

Rank 3 · TkAUNG024020 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkAUNG024020 · TK1151

Mitochondrion0.034

Rank 5 · TkAUNG024020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06244Ccdc12410-24 aa

PF04690YABBY62-123 aa

PF00505HMG_box63-81 aa

PF06244Ccdc12475-119 aa

PF09011HMG_box_277-119 aa

PF00505HMG_box82-118 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG024020	`PF06244`	Ccdc124	10	24	0.0087	17.1
TkAUNG024020	`PF04690`	YABBY	62	123	2.7e-33	114.9
TkAUNG024020	`PF00505`	HMG_box	63	81	0.0006	20.9
TkAUNG024020	`PF06244`	Ccdc124	75	119	0.0087	17.1
TkAUNG024020	`PF09011`	HMG_box_2	77	119	1.8e-05	26.0
TkAUNG024020	`PF00505`	HMG_box	82	118	0.0006	20.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22152`	Arabidopsis thaliana	sp\|O22152\|YAB1_ARATH Axial regulator YABBY 1	75.400%	Swiss-Prot	Low
`Q8L925`	Arabidopsis thaliana	sp\|Q8L925\|CRC_ARATH Protein CRABS CLAW	76.500%	Swiss-Prot	Low
`Q76EJ0`	Oryza sativa subsp. japonica	sp\|Q76EJ0\|YABDL_ORYSJ Protein DROOPING LEAF	60.000%	Swiss-Prot	High
`Q7XIM7`	Oryza sativa subsp. japonica	sp\|Q7XIM7\|YAB1_ORYSJ Protein YABBY 1	69.500%	Swiss-Prot	Low
`Q10FZ7`	Oryza sativa subsp. japonica	sp\|Q10FZ7\|YAB2_ORYSJ Protein YABBY 2	78.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card