LXL04_025104 | RubberDandelionOmics

Gene overview

LXL04_025104

Reference: OH-1004 Chr: Chr05 Coordinates: 105997703-105999573 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

646 bp · LXL04_025104|LXL04_025104|OH1004|cDNA

ATGAAGCCTTTTTCATATGCAAAATATCTCTCTTGATATATTGATAATCATCAATTAATACAAGAACTTTACTACATCGATCATTGTTTCCATTCGTGTGATCATGAACTTTGAAGTGCAAGCTGAGAGGGTGGCAAACATGGATCCGCCTGTTCAAACACCTCCCTCCGATCAACATCTTTGCTACGTTCGTTGCAACTTTTGCAATACCCTTCTTGCGGTAGGAATACCATGCAAGAGGCTACTGGATACAGTCACAG...

CDS

Download CDS FASTA

543 bp · LXL04_025104|LXL04_025104|OH1004|CDS

ATGAACTTTGAAGTGCAAGCTGAGAGGGTGGCAAACATGGATCCGCCTGTTCAAACACCTCCCTCCGATCAACATCTTTGCTACGTTCGTTGCAACTTTTGCAATACCCTTCTTGCGGTAGGAATACCATGCAAGAGGCTACTGGATACAGTCACAGTGAAATGCGGACATTGCAGCAATTTGTCATTTCTCACGATAAGACCTTCTCCTCCAGATCATCTTCTTCAACCTCCTCCCCTTCCTTCTTTTCCGTCTGCTTT...

Protein

Download Protein FASTA

180 aa · LXL04_025104|LXL04_025104|OH1004|PROTEIN

MNFEVQAERVANMDPPVQTPPSDQHLCYVRCNFCNTLLAVGIPCKRLLDTVTVKCGHCSNLSFLTIRPSPPDHLLQPPPLPSFPSAFSGDLKRGQSSSSSSSTSNEPTSPKAPFVVKPPEKKHRLPSAYNRFMKEEIQRIKASNPQIPHREAFSTAAKNWAGHIPNGSISGSINTVRILP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025104`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025104

Location Chr05:105997703-105999573 (-)

Description Similar to DL: Protein DROOPING LEAF

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69180`	Transcription factor required for the initiation of nectary development.	No verified direct reference in this release
`At2g26580`	Promotes adaxial cell identity.	No verified direct reference in this release
`At1g08465`	Involved in the abaxial cell fate determination during embryogenesis and organogenesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0215200`	Regulates carpel specification in flower development.	No verified direct reference in this release
`Os03g0650000`	Protein YABBY 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025104 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003002 regionalization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0010022 meristem determinacy Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0010158 abaxial cell fate specification Biological Process

GO:0010254 nectary development Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0045165 cell fate commitment Biological Process

GO:0048366 leaf development Biological Process

GO:0048440 carpel development Biological Process

KEGG gene cross-reference

ath:AT1G08465

ath:AT1G69180

ath:AT2G26580

dosa:Os03g0215200

dosa:Os03g0650000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.808

Rank 1 · LXL04_025104 · OH-1004

Cytoplasm0.266

Rank 2 · LXL04_025104 · OH-1004

Cell membrane0.050

Rank 3 · LXL04_025104 · OH-1004

Endoplasmic reticulum0.041

Rank 4 · LXL04_025104 · OH-1004

Mitochondrion0.020

Rank 5 · LXL04_025104 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24868.1YABBY_N23-68 aa

PF04690.20YABBY104-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025104	`PF24868.1`	YABBY_N	23	68	4e-23	81.5
LXL04_025104	`PF04690.20`	YABBY	104	165	4.1e-33	114.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L925`	Arabidopsis thaliana	Protein CRABS CLAW	65.306%	Swiss-Prot	strong database homology
`Q8GW46`	Arabidopsis thaliana	Axial regulator YABBY 5	49.324%	Swiss-Prot	moderate database homology
`Q9XFB0`	Arabidopsis thaliana	Putative axial regulator YABBY 2	51.282%	Swiss-Prot	strong database homology
`Q76EJ0`	Oryza sativa subsp. japonica	Protein DROOPING LEAF	67.347%	Swiss-Prot	strong database homology
`Q10FZ7`	Oryza sativa subsp. japonica	Protein YABBY 2	45.283%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card