TkAUNG023070 | RubberDandelionOmics

Gene overview

TkAUNG023070

Reference: TK1151 Chr: ChrUn Coordinates: 6207579-6209347 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

852 bp · TkAUNG023070|TK1151|cDNA

ATGAGGACTGGGTCTGAGTGCATGGAGAAGGTACAGGAGTTAAAAACAGAGAATGTGTCATTTACAAAATCGTGGGCCAAAGGAAAGAATGTTTGTTCATACGAGCAAATGGAGATTCCAAAGAGTCCTTACCAGGCGATGGAGTTCCTGAGTCGACCTTGGAGCCCGTCTTCATCCGATTTCCTGCAAATATCTTCGACCAATAATCTCTTGCTGCGAAGTAACACAAACGAAGAAGCTGATGAAGGCGTTGCAAGGAC...

CDS

Download CDS FASTA

852 bp · TkAUNG023070|TK1151|CDS

ATGAGGACTGGGTCTGAGTGCATGGAGAAGGTACAGGAGTTAAAAACAGAGAATGTGTCATTTACAAAATCGTGGGCCAAAGGAAAGAATGTTTGTTCATACGAGCAAATGGAGATTCCAAAGAGTCCTTACCAGGCGATGGAGTTCCTGAGTCGACCTTGGAGCCCGTCTTCATCCGATTTCCTGCAAATATCTTCGACCAATAATCTCTTGCTGCGAAGTAACACAAACGAAGAAGCTGATGAAGGCGTTGCAAGGAC...

Protein

Download Protein FASTA

283 aa · TkAUNG023070|TK1151|PROTEIN

MRTGSECMEKVQELKTENVSFTKSWAKGKNVCSYEQMEIPKSPYQAMEFLSRPWSPSSSDFLQISSTNNLLLRSNTNEEADEGVARTHISSLNQDNIEIDFIQPKTWLRARTLTSLLRSRKEKKKEDKRLQTAQLHAALSLTQLAAAIAGISRSQESSPASWQGMGGVISSAASLISDVCAEAAESLGAKRAQTRAAFESGMAVQNPIDMIEVTATAATCLRGAALLKSRASTLPISRIQETLKISAEILTIMPSVAVRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG023070`
TK1151 ID	TkAUNG023070
OH-1004 ID	LXL04_018787
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	49.100
Protein coverage (%)	TK1151 20.141 / OH-1004 11.777 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG023070`
Location	ChrUn:6207579-6209347 (-)
Description	Similar to VAB: VAN3-binding protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018787` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006892 post-Golgi vesicle-mediated transport Biological Process GO:0009733 response to auxin Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0010087 phloem or xylem histogenesis Biological Process GO:0010305 leaf vascular tissue pattern formation Biological Process GO:0005634 nucleus Cellular Component GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference	ath:AT3G63300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.425

Rank 1 · TkAUNG023070 · TK1151

Cytoplasm0.389

Rank 2 · TkAUNG023070 · TK1151

Cell membrane0.222

Rank 3 · TkAUNG023070 · TK1151

Endoplasmic reticulum0.065

Rank 4 · TkAUNG023070 · TK1151

Mitochondrion0.060

Rank 5 · TkAUNG023070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05703Auxin_canalis40-69 aa

PF05703Auxin_canalis102-232 aa

PF13384HTH_23124-155 aa

PF26534NTF2_7175-220 aa

PF13384HTH_23181-193 aa

PF13384HTH_23222-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG023070	`PF05703`	Auxin_canalis	40	69	6.2e-34	118.8
TkAUNG023070	`PF05703`	Auxin_canalis	102	232	6.2e-34	118.8
TkAUNG023070	`PF13384`	HTH_23	124	155	6.2	7.5
TkAUNG023070	`PF26534`	NTF2_7	175	220	0.03	15.1
TkAUNG023070	`PF13384`	HTH_23	181	193	6.2	7.5
TkAUNG023070	`PF13384`	HTH_23	222	246	6.2	7.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card