TkAUNG022460 | RubberDandelionOmics

Gene overview

TkAUNG022460

Reference: TK1151 Chr: ChrUn Coordinates: 5976539-5984817 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2109 bp · TkAUNG022460|TK1151|cDNA

CACATACATACACACATGCACATACACACAAACATACACACTCTCTCTCCTTCCCTTCTCTCTCTCCAGTCTCTTCAAGTGTCATTTTCTCACATATACTTCACATAAAAGATACAACCATTCACTTAATAGCTTGTCATCTCTCTCCCTCCATCCCACTCTCTCTCTAAAACTGCACAACTACTCCCAATTCACCATTGATTATAGCCAAATCCCATCTCAAGAATTCTTCAGAAAAAACCTTCATATCATCATCATAC...

CDS

Download CDS FASTA

1143 bp · TkAUNG022460|TK1151|CDS

ATGGAGCTCTTTCCAGCACAACCAGACTTGTCTCTTCAAATCAGTCCACCCACCACCAAACCCACTTCAAAAACATGGAGAACATCATCAACAACAAACGATCATCATCATCATCATCATCAAGATCACCATGATTTGGATTTGGGAAATCTATGGAAAAGAGCGTTAAACTCTCAACAACTACAGCAACAGCAACAACAGCAACAACAACAATATAACCACTCAACAAGAAGACCAGAAGTACCTTCTTTCGGGCTTTC...

Protein

Download Protein FASTA

380 aa · TkAUNG022460|TK1151|PROTEIN

MELFPAQPDLSLQISPPTTKPTSKTWRTSSTTNDHHHHHHQDHHDLDLGNLWKRALNSQQLQQQQQQQQQQYNHSTRRPEVPSFGLSLTNPINPSSNSDFHNLLSQNTNSPSSNMSYPNFQQHHQAAGFSSELGFLRPIRGIPVYYQNPPPNFPIMANPHHKNQPSLDSCANSTTTSSLIHGNNINNIVRSRFLSSRFPPKRSMRAPRMRWTTTLHARFVHAVELLGGHERATPKSVLELMDVKDLTLSHVKSHLQMYRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG022460`
TK1151 ID	TkAUNG022460
OH-1004 ID	LXL04_026112
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG022460

Location ChrUn:5976539-5984817 (-)

Description Similar to KAN2: Probable transcription factor KAN2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32240`	Probable transcription factor that regulates lateral organ polarity.	ABERRANT TESTA SHAPE encodes a KANADI family member, linking polarity determination to separation and growth of Arabidopsis ovule integuments.2006 · DOI: 10.1111/j.1365-313x.2006.02717.x KANADI and class III HD-Zip gene families regulate embryo patterning and modulate auxin flow during embryogenesis in Arabidopsis.2007 · DOI: 10.1105/tpc.106.047472
`At5g16560`	Transcriptional repressor that regulates lateral organ polarity.	ABERRANT TESTA SHAPE encodes a KANADI family member, linking polarity determination to separation and growth of Arabidopsis ovule integuments.2006 · DOI: 10.1111/j.1365-313x.2006.02717.x KANADI and class III HD-Zip gene families regulate embryo patterning and modulate auxin flow during embryogenesis in Arabidopsis.2007 · DOI: 10.1105/tpc.106.047472 KANADI1 regulates adaxial-abaxial polarity in Arabidopsis by directly repressing the transcription of ASYMMETRIC LEAVES2.2008 · DOI: 10.1073/pnas.0803997105
`At4g17695`	Probable transcription factor that regulates lateral organ polarity.	No verified direct reference in this release
`At5g42630`	Probable transcription factor that regulates carpel integuments formation.	ABERRANT TESTA SHAPE encodes a KANADI family member, linking polarity determination to separation and growth of Arabidopsis ovule integuments.2006 · DOI: 10.1111/j.1365-313x.2006.02717.x A new dominant Arabidopsis transparent testa mutant, sk21-D, and modulation of seed flavonoid biosynthesis by KAN4.2010 · DOI: 10.1111/j.1467-7652.2010.00525.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0395300`	Probable transcription factor that regulates abaxial identity during leaf development.	SHALLOT-LIKE1 is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development.2009 · DOI: 10.1105/tpc.108.061457

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026112 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009943 adaxial/abaxial axis specification Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0009956 radial pattern formation Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010158 abaxial cell fate specification Biological Process

GO:0010229 inflorescence development Biological Process

GO:0048440 carpel development Biological Process

GO:0048481 plant ovule development Biological Process

GO:0080060 integument development Biological Process

GO:1905392 plant organ morphogenesis Biological Process

KEGG gene cross-reference

ath:AT1G32240

ath:AT4G17695

ath:AT5G16560

ath:AT5G42630

dosa:Os09g0395300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · TkAUNG022460 · TK1151

Cytoplasm0.081

Rank 2 · TkAUNG022460 · TK1151

Cell membrane0.022

Rank 3 · TkAUNG022460 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkAUNG022460 · TK1151

Plastid0.011

Rank 5 · TkAUNG022460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding208-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG022460	`PF00249`	Myb_DNA-binding	208	259	1.5e-06	28.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C616`	Arabidopsis thaliana	sp\|Q9C616\|KAN2_ARATH Probable transcription factor KAN2	45.300%	Swiss-Prot	Medium
`Q93WJ9`	Arabidopsis thaliana	sp\|Q93WJ9\|KAN1_ARATH Transcription repressor KAN1	49.300%	Swiss-Prot	Medium
`Q941I2`	Arabidopsis thaliana	sp\|Q941I2\|KAN3_ARATH Probable transcription factor KAN3	42.400%	Swiss-Prot	Medium
`Q9FJV5`	Arabidopsis thaliana	sp\|Q9FJV5\|KAN4_ARATH Probable transcription factor KAN4	46.400%	Swiss-Prot	Low
`Q0J235`	Oryza sativa subsp. japonica	sp\|Q0J235\|ROLL9_ORYSJ Probable transcription factor RL9	82.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card